Gene/Protein Characteristic Table for KIAA0755
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00623
Accession No AB018298
Description SEC24 homolog D, COPII coat complex component
Clone name hk04532
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (3988 bp)
Predicted protein sequence (1093 aa)
Flexi ORF Clone FXC00623
Source Human adult brain
Features of the cloned cDNA sequence
Description

Length: 3988 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 1093 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAD28756 0 100.0 sec24D protein ...
Homo sapiens
O94855 0 99.9 Protein transpo...
Homo sapiens
BAF84454 0 99.7 unnamed protein...
Homo sapiens
AAH35761 0 99.8 SEC24 related g...
Homo sapiens
XP_001503301 0 92.7 similar to SEC2...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
D38555 5.6e-73 56.5 KIAA0079
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR006895 420 459 PF04810 Zinc finger
IPR006896 498 745 PF04811 Sec23/Sec24 trunk region
IPR012990 747 831 PF08033 Sec23/Sec24 beta-sandwich
IPR006900 843 946 PF04815 Sec23/Sec24 helical region
IPR007123 960 1035 PF00626 Gelsolin region
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GATAATCTCCTTCTTGGTGCC
Primer_r TCTAAATGCCATCTCTTCCTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 4
Experimental conditions
Panel name GeneBridge 4
Primer_f GATAATCTCCTTCTTGGTGCC
Primer_r TCTAAATGCCATCTCTTCCTG
PCR product length 102 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp