Order Kazusa clone(s) from : 
Japan
||
Other countries |
|
Order Kazusa clone(s) from :
Japan
||
Other countries |
| Product ID | ORK00406 |
|---|---|
| Accession No | D42055 |
| Description | neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase, transcript variant 1 |
| Clone name | ha00935 |
| Vector information |
The cDNA fragment was inserted at the EcoRV-NotI site of the ...
|
| cDNA sequence | DNA sequence (5749 bp) Predicted protein sequence (927 aa) |
|
HaloTag ORF Clone |
FHC00406
|
| Flexi ORF Clone | FXC00406 |
| Source | Myeloblast cell line (KG-1) |
| Rouge ID |
mKIAA0093
by Kazusa Mouse cDNA Project
|
Length: 5749 bp Physical map
Restriction map Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 2964 bp |
|---|---|
| Genome contig ID | gi51511731r_53806423 |
| PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 15 | r | 53906423 | 54073127 | 29 | 99.4 | Perfect prediction |
Length: 927 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment) |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment) |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI) Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| FPrintScan | IPR000008 | 63 | 75 | PR00360 | C2 calcium-dependent membrane targeting |
| IPR000008 | 93 | 106 | PR00360 | C2 calcium-dependent membrane targeting | |
| HMMPfam | IPR000008 | 48 | 134 | PF00168 | C2 calcium-dependent membrane targeting |
| IPR001202 | 220 | 249 | PF00397 | WW/Rsp5/WWP | |
| IPR001202 | 377 | 406 | PF00397 | WW/Rsp5/WWP | |
| IPR001202 | 450 | 479 | PF00397 | WW/Rsp5/WWP | |
| IPR001202 | 502 | 531 | PF00397 | WW/Rsp5/WWP | |
| IPR000569 | 621 | 926 | PF00632 | HECT | |
| HMMSmart | IPR000008 | 47 | 149 | SM00239 | C2 calcium-dependent membrane targeting |
| IPR001202 | 219 | 251 | SM00456 | WW/Rsp5/WWP | |
| IPR001202 | 376 | 408 | SM00456 | WW/Rsp5/WWP | |
| IPR001202 | 449 | 481 | SM00456 | WW/Rsp5/WWP | |
| IPR001202 | 501 | 533 | SM00456 | WW/Rsp5/WWP | |
| IPR000569 | 590 | 926 | SM00119 | HECT | |
| ProfileScan | IPR000008 | 48 | 134 | PS50004 | C2 calcium-dependent membrane targeting |
| IPR001202 | 218 | 251 | PS50020 | WW/Rsp5/WWP | |
| IPR001202 | 375 | 408 | PS50020 | WW/Rsp5/WWP | |
| IPR001202 | 448 | 481 | PS50020 | WW/Rsp5/WWP | |
| IPR001202 | 500 | 533 | PS50020 | WW/Rsp5/WWP | |
| IPR000569 | 592 | 926 | PS50237 | HECT | |
| ScanRegExp | IPR001202 | 224 | 249 | PS01159 | WW/Rsp5/WWP |
| IPR001202 | 381 | 406 | PS01159 | WW/Rsp5/WWP | |
| IPR001202 | 454 | 479 | PS01159 | WW/Rsp5/WWP | |
| IPR001202 | 506 | 531 | PS01159 | WW/Rsp5/WWP |
Chromosome No. 15 Experimental conditions| Panel name | Genebridge 4 |
|---|---|
| Primer_f | TGTGCTATGCTCTGGGGTAAG |
| Primer_r | TGCTGATGCTGTGGTGTTTGG |
| PCR product length | 491 bp |
| PCR conditions | 95 °C 15 sec64 °C60 sec30 cycles |
Japan
||
Other countries
