Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK05590 |
---|---|
Accession No | AB002310 |
Description | HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase |
Clone name | ff01724c1 |
Vector information | |
cDNA sequence | DNA sequence (10790 bp) Predicted protein sequence (3192 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA0312
by Kazusa Mouse cDNA Project
|
Note | We replaced ff01724 and hg00137, former representative clones for KIAA0312 with ff01724c1. (2011/09/22,2003/8/28) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000449 | 152 | 190 | PF00627 | Ubiquitin-associated/Translation elongation factor EF1B |
IPR004170 | 444 | 515 | PF02825 | WWE | |
IPR000569 | 2885 | 3192 | PF00632 | HECT | |
HMMSmart | IPR000449 | 153 | 189 | SM00165 | Ubiquitin-associated/Translation elongation factor EF1B |
IPR000569 | 2854 | 3192 | SM00119 | HECT | |
ProfileScan | IPR000449 | 151 | 190 | PS50030 | Ubiquitin-associated/Translation elongation factor EF1B |
IPR004170 | 438 | 515 | PS50918 | WWE | |
IPR000569 | 2856 | 3192 | PS50237 | HECT |
RT-PCR |
---|
Primer_f | AGCCCAAAGCCTTCAGAGCAC |
---|---|
Primer_r | ATCGAGATGACAGGTCCACAG |
PCR conditions | 95 °C15 sec64 °C15 sec72 °C45 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AGCCCAAAGCCTTCAGAGCAC |
Primer_r | ATCGAGATGACAGGTCCACAG |
PCR product length | 141 (0.8k) bp |
PCR conditions | 95 °C15 sec66 °C60 sec30 cycles |