Gene/Protein Characteristic Table for KIAA0312
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05590
Accession No AB002310
Description HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase
Clone name ff01724c1
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (10790 bp)
Predicted protein sequence (3192 aa)
Source Human fetal brain
Rouge ID mKIAA0312 by Kazusa Mouse cDNA Project
Note We replaced ff01724 and hg00137, former representative clones for KIAA0312 with ff01724c1. (2011/09/22,2003/8/28)
Features of the cloned cDNA sequence
Description

Length: 10790 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 3192 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW93160 0 99.0 HECT, UBA and W...
Homo sapiens
XP_001362150 0 95.3 e3 ubiquitin-pr...
Monodelphis dom...
XP_001923899 0 88.9 HECT, UBA and W...
Danio rerio
XP_002831735 0 99.3 LOW QUALITY PRO...
Pongo abelii
XP_001089097 0 99.4 e3 ubiquitin-pr...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB046798 0 0 KIAA1578
AB007899 9.8e-195 98.9 KIAA0439
D42055 6.2e-27 62.5 KIAA0093
AB046845 2.2e-26 74.6 KIAA1625
AB037722 3.6e-25 74.8 KIAA1301
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000449 152 190 PF00627 Ubiquitin-associated/Translation elongation factor EF1B
IPR004170 444 515 PF02825 WWE
IPR000569 2885 3192 PF00632 HECT
HMMSmart IPR000449 153 189 SM00165 Ubiquitin-associated/Translation elongation factor EF1B
IPR000569 2854 3192 SM00119 HECT
ProfileScan IPR000449 151 190 PS50030 Ubiquitin-associated/Translation elongation factor EF1B
IPR004170 438 515 PS50918 WWE
IPR000569 2856 3192 PS50237 HECT
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f AGCCCAAAGCCTTCAGAGCAC
Primer_r ATCGAGATGACAGGTCCACAG
PCR conditions 95 °C15 sec64 °C15 sec72 °C45 sec30 cycles

RH mapping information
Description

Chromosome No. X
Experimental conditions
Panel name GeneBridge 4
Primer_f AGCCCAAAGCCTTCAGAGCAC
Primer_r ATCGAGATGACAGGTCCACAG
PCR product length 141 (0.8k) bp
PCR conditions 95 °C15 sec66 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp