KIAA1625

Product ID	ORK00259
Accession No	AB046845
Description	SMAD specific E3 ubiquitin protein ligase 1, transcript variant 1
Clone name	hh15184
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5725 bp) Predicted protein sequence (859 aa)
HaloTag ORF Clone	FHC00259
Flexi ORF Clone	FXC00259
Source	Human adult brain
Rouge ID	mKIAA1625 by Kazusa Mouse cDNA Project

Length: 5725 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3143 bp
Genome contig ID	gi89161213r_98363000
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- TCATTTTGTTACATATGCAATAAACTCACGACTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACATTTTTGGCGTCTGTTATTTTGGTGTGGAAATGAGATTCTAGTGTCTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	r	98463000	98579659	19	99.7	Perfect prediction

Length: 859 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9HCE7	0	100.0	E3 ubiquitin-pr...	Homo sapiens
XP_528043	0	99.6	Smad ubiquitina...	Pan troglodytes
EAW76686	0	100.0	SMAD specific E...	Homo sapiens
XP_001510726	3.6e-202	72.9	hypothetical pr...	Ornithorhynchus...
XP_511577	1.7e-201	68.4	SMAD specific E...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007899	3.9e-55	44.2	KIAA0439
D42055	8.4e-55	45.4	KIAA0093
AB037722	5e-50	45.9	KIAA1301
AB002320	3.2e-49	46.9	KIAA0322
AB002310	2.5e-44	45.5	KIAA0312

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000008	117	201	PF00168	C2 calcium-dependent membrane targeting
	IPR001202	338	367	PF00397	WW/Rsp5/WWP
	IPR001202	410	439	PF00397	WW/Rsp5/WWP
	IPR000569	551	859	PF00632	HECT
HMMSmart	IPR000008	116	219	SM00239	C2 calcium-dependent membrane targeting
	IPR001202	337	369	SM00456	WW/Rsp5/WWP
	IPR001202	409	441	SM00456	WW/Rsp5/WWP
	IPR000569	520	859	SM00119	HECT
ProfileScan	IPR000008	116	201	PS50004	C2 calcium-dependent membrane targeting
	IPR001202	336	369	PS50020	WW/Rsp5/WWP
	IPR001202	408	441	PS50020	WW/Rsp5/WWP
	IPR000569	522	859	PS50237	HECT
ScanRegExp	IPR001202	414	439	PS01159	WW/Rsp5/WWP

Primer_f	CCAGATAATGAAGATGCGACC
Primer_r	CTGGAAGAGCCCGTAATAAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-