KIAA1301

Product ID	ORK00211
Accession No	AB037722
Description	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2, transcript variant 1
Clone name	fg06833
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6926 bp) Predicted protein sequence (1581 aa)
Flexi ORF Clone	FXC00211
Source	Human fetal brain
Rouge ID	mKIAA1301 by Kazusa Mouse cDNA Project

Length: 6926 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2024 bp
Genome contig ID	gi89161199r_196672222
PolyA signal sequence (AATACA,-25)	+--------+--------+----*----+---- ATTGATCATGAATACAAGTATATATTTAATTTTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACTTTTCACTTGTTTGTATTCTTTTCATTATAAGGAAAAGTAGTATAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	196772222	197165580	29	99.5	Perfect prediction

Length: 1581 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P2P5	100.0	E3 ubiquitin-pr...	Homo sapiens
XP_516001	99.6	HECT, C2 and WW...	Pan troglodytes
XP_001917812	96.6	HECT, C2 and WW...	Equus caballus
Q6I6G8	94.7	E3 ubiquitin-pr...	Mus musculus
EDL99066	94.3	similar to HECT...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002320	7.4e-132	57.0	KIAA0322
AB007899	2.3e-49	36.0	KIAA0439
D42055	1.2e-43	36.8	KIAA0093
AB046845	3.6e-39	45.9	KIAA1625
AB002310	6.9e-32	34.5	KIAA0312

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000008	196	291	PF00168	C2 calcium-dependent membrane targeting
	IPR001202	818	847	PF00397	WW/Rsp5/WWP
	IPR001202	996	1025	PF00397	WW/Rsp5/WWP
	IPR000569	1276	1581	PF00632	HECT
HMMSmart	IPR000008	195	306	SM00239	C2 calcium-dependent membrane targeting
	IPR001202	817	849	SM00456	WW/Rsp5/WWP
	IPR001202	995	1027	SM00456	WW/Rsp5/WWP
	IPR000569	1244	1581	SM00119	HECT
ProfileScan	IPR000008	195	291	PS50004	C2 calcium-dependent membrane targeting
	IPR001202	816	849	PS50020	WW/Rsp5/WWP
	IPR001202	994	1027	PS50020	WW/Rsp5/WWP
	IPR000569	1246	1581	PS50237	HECT
ScanRegExp	IPR001202	822	847	PS01159	WW/Rsp5/WWP
ScanRegExp	IPR001202	1000	1025	PS01159	WW/Rsp5/WWP

Primer_f	GACATGGTTCCAGTGGCTTAC
Primer_r	AACATAACAAGGTCTGCATCG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AGACACAGGGACTTCCGATGC
Primer_r	TGGTCACACTCTCATTGCAGG
PCR product length	212 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles