Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK05475 |
---|---|
Accession No | AB046798 |
Description | HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase |
Clone name | fj04270 |
Vector information | |
cDNA sequence | DNA sequence (3670 bp) Predicted protein sequence (1202 aa) |
Source | Human fetal brain |
Note | Please refer to "Gene/Protein Characteristic Table for KIAA0312" because the cDNA sequence of KIAA1578 is included in KIAA0312. |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000449 | 72 | 110 | PF00627 | Ubiquitin-associated/Translation elongation factor EF1B |
IPR004170 | 364 | 435 | PF02825 | WWE | |
HMMSmart | IPR000449 | 73 | 109 | SM00165 | Ubiquitin-associated/Translation elongation factor EF1B |
ProfileScan | IPR000449 | 71 | 110 | PS50030 | Ubiquitin-associated/Translation elongation factor EF1B |
IPR004170 | 358 | 435 | PS50918 | WWE |
RT-PCR-ELISA |
Primer_f | AACATCATTCGGCTTTTCCTG |
---|---|
Primer_r | TACTGGGCTGGTTCACAATCC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | CCR |
---|---|
Primer_f | CAGAGCAGTGACTTTGATACG |
Primer_r | GAGGTAGGCATTAAAGGTTTG |
PCR product length | 218(1.6k) bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |