Gene/Protein Characteristic Table for KIAA1578
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05475
Accession No AB046798
Description HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase
Clone name fj04270
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (3670 bp)
Predicted protein sequence (1202 aa)
Source Human fetal brain
Note Please refer to "Gene/Protein Characteristic Table for KIAA0312" because the cDNA sequence of KIAA1578 is included in KIAA0312.
Features of the cloned cDNA sequence
Description

Length: 3670 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 1202 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAC06833 0 98.3 HECT domain pro...
Homo sapiens
CAI39581 0 98.3 HECT, UBA and W...
Homo sapiens
EAW93160 0 98.3 HECT, UBA and W...
Homo sapiens
EAW93162 0 98.3 HECT, UBA and W...
Homo sapiens
AAV90838 0 98.3 ARF-binding pro...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB002310 0 98.2 KIAA0312
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000449 72 110 PF00627 Ubiquitin-associated/Translation elongation factor EF1B
IPR004170 364 435 PF02825 WWE
HMMSmart IPR000449 73 109 SM00165 Ubiquitin-associated/Translation elongation factor EF1B
ProfileScan IPR000449 71 110 PS50030 Ubiquitin-associated/Translation elongation factor EF1B
IPR004170 358 435 PS50918 WWE
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f AACATCATTCGGCTTTTCCTG
Primer_r TACTGGGCTGGTTCACAATCC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. X
Experimental conditions
Panel name CCR
Primer_f CAGAGCAGTGACTTTGATACG
Primer_r GAGGTAGGCATTAAAGGTTTG
PCR product length 218(1.6k) bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp