Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK01968 |
---|---|
Accession No | D87443 |
Description | sorting nexin 19, transcript variant 1 |
Clone name | ha07011 |
Vector information | |
cDNA sequence | DNA sequence (6049 bp) Predicted protein sequence (1009 aa) |
HaloTag ORF Clone |
FHC01968
|
Flexi ORF Clone | FXC01968 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0254
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2542 bp |
---|---|
Genome contig ID | gi51511727r_130150985 |
PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 11 | r | 130250985 | 130291572 | 11 | 99.1 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR003114 | 112 | 289 | PF02194 | PX-associated |
IPR001683 | 544 | 676 | PF00787 | Phox-like | |
IPR013937 | 855 | 964 | PF08628 | Sorting nexin | |
HMMSmart | IPR013996 | 112 | 289 | SM00313 | PX-associated |
IPR001683 | 544 | 676 | SM00312 | Phox-like | |
ProfileScan | IPR003114 | 112 | 289 | PS51207 | PX-associated |
IPR001683 | 550 | 680 | PS50195 | Phox-like |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 46 | LMAVGVLLGWLLVIHLLVNVWLL | 68 | PRIMARY | 23 | 2 | 73 | ALLVVLGGWLGSSLAGVASGRLH | 95 | PRIMARY | 23 |
---|
Panel name | Genebridge 4 |
---|---|
Primer_f | GAATTGGGCCTGTGCTGATCC |
Primer_r | ACAGAAAGAACACAGCATCCC |
PCR product length | 172 bp |
PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |