KIAA0272

Product ID	ORK00486
Accession No	D87462
Description	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)
Clone name	ha06802s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pSPORT1 vector (GenBank Accession No. U12390, AmpR). The 5' end of the cDNA sequence (SalI-GTCGACGGTA TCGATAAGCT TGAT) was derived from pBluescriptIISKplus vector.
cDNA sequence	DNA sequence (3589 bp) Predicted protein sequence (759 aa)
HaloTag ORF Clone	FHC00486
Flexi ORF Clone	FXC00486
Source	Human adult brain
Rouge ID	mKIAA0272 by Kazusa Mouse cDNA Project
Note	We replaced ha06802, former representative clones for KIAA0272 with ha06802s1. (2002/5/10)

Length: 3589 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1275 bp
Genome contig ID	gi89161205r_52310069
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- CAATGAATGAATAAAACTCTCCTAAGAATCTCCTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGAAATGAACCCTCCTGTGGTTGCTGGCCTGAGATATGGAGGCTGGGCCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	52410069	52419058	17	100.0	Perfect prediction

Length: 759 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q92560	100.0	Ubiquitin carbo...	Homo sapiens
XP_001171970	99.7	BRCA1 associate...	Pan troglodytes
XP_001089173	98.6	similar to BRCA...	Macaca mulatta
XP_541853	96.0	similar to BRCA...	Canis lupus fam...
XP_001493524	95.3	BRCA1 associate...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001578	42	262	PD350662	Peptidase C12
FPrintScan	IPR001578	37	54	PR00707	Peptidase C12
	IPR001578	115	132	PR00707	Peptidase C12
	IPR001578	210	220	PR00707	Peptidase C12
HMMPfam	IPR001578	34	246	PF01088	Peptidase C12

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	ACAGCAGGATCAAGACAACCC
Primer_r	CCCCACTCAGTCACTATGTAC
PCR product length	183 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles