Order Kazusa clone(s) from : ![]() |
Product ID | ORK00486 |
---|---|
Accession No | D87462 |
Description | BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase) |
Clone name | ha06802s1 |
Vector information | |
cDNA sequence | DNA sequence (3589 bp) Predicted protein sequence (759 aa) |
HaloTag ORF Clone |
FHC00486
![]() |
Flexi ORF Clone | FXC00486 |
Source | Human adult brain |
Rouge ID |
mKIAA0272
by Kazusa Mouse cDNA Project
|
Note | We replaced ha06802, former representative clones for KIAA0272 with ha06802s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1275 bp |
---|---|
Genome contig ID | gi89161205r_52310069 |
PolyA signal sequence (AATAAA,-26) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | r | 52410069 | 52419058 | 17 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Genebridge 4 |
---|---|
Primer_f | ACAGCAGGATCAAGACAACCC |
Primer_r | CCCCACTCAGTCACTATGTAC |
PCR product length | 183 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |