KIAA0287

Product ID	ORK00496
Accession No	AB006625
Description	paternally expressed 3, transcript variant 5
Clone name	fg06332
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5994 bp) Predicted protein sequence (1523 aa)
HaloTag ORF Clone	FHC00496
Flexi ORF Clone	FXC00496
Source	Human fetal brain
Rouge ID	mKIAA0287 by Kazusa Mouse cDNA Project
Note	We replaced ha06162, former representative clones for KIAA0287 with fg06332. (2001/5/29)

Length: 5994 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1244 bp
Genome contig ID	gi42406306r_61915612
PolyA signal sequence (None)	+--------+--------+----*----+---- TATCTGACCCTCTAACTCCATGTCTAACTTGCATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAATTCTTTACAGTCAACCCAAGCTTAACATGGACTCAGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	r	62015612	62043879	9	99.1	Perfect prediction

Length: 1523 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW72477	99.9	hCG1685807, iso...	Homo sapiens
Q9GZU2	99.8	Paternally-expr...	Homo sapiens
A1YFC1	98.9	Paternally-expr...	Gorilla gorilla...
A2T7F2	98.9	Paternally-expr...	Pan troglodytes
A1YGK6	98.8	Paternally-expr...	Pan paniscus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002324	3e-16	26.7	KIAA0326
AB075836	3.7e-14	30.4	KIAA1956
AB037770	7.8e-14	27.2	KIAA1349
AB058755	1.7e-12	25.8	KIAA1852
AB058730	4e-12	27.2	KIAA1827

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	498	520	PD000003	Zinc finger
	IPR007087	562	585	PD000003	Zinc finger
	IPR007087	904	926	PD000003	Zinc finger
	IPR007087	1267	1287	PD000003	Zinc finger
HMMPfam	IPR003309	2	71	PF02023	Transcriptional regulator SCAN
	IPR007087	387	409	PF00096	Zinc finger
	IPR007087	440	462	PF00096	Zinc finger
	IPR007087	498	520	PF00096	Zinc finger
	IPR007087	562	584	PF00096	Zinc finger
	IPR007087	904	926	PF00096	Zinc finger
	IPR007087	1042	1064	PF00096	Zinc finger
	IPR007087	1098	1120	PF00096	Zinc finger
	IPR007087	1160	1182	PF00096	Zinc finger
	IPR007087	1217	1239	PF00096	Zinc finger
	IPR007087	1267	1289	PF00096	Zinc finger
	IPR007087	1440	1462	PF00096	Zinc finger
	IPR007087	1499	1521	PF00096	Zinc finger
HMMSmart	IPR003309	3	81	SM00431	Transcriptional regulator SCAN
	IPR015880	387	409	SM00355	Zinc finger
	IPR015880	440	462	SM00355	Zinc finger
	IPR015880	498	520	SM00355	Zinc finger
	IPR015880	562	584	SM00355	Zinc finger
	IPR015880	904	926	SM00355	Zinc finger
	IPR015880	1042	1064	SM00355	Zinc finger
	IPR015880	1098	1120	SM00355	Zinc finger
	IPR015880	1160	1182	SM00355	Zinc finger
	IPR015880	1217	1239	SM00355	Zinc finger
	IPR015880	1267	1289	SM00355	Zinc finger
	IPR015880	1440	1462	SM00355	Zinc finger
	IPR015880	1499	1521	SM00355	Zinc finger
ProfileScan	IPR003309	7	58	PS50804	Transcriptional regulator SCAN
	IPR007087	387	414	PS50157	Zinc finger
	IPR007087	440	463	PS50157	Zinc finger
	IPR007087	498	525	PS50157	Zinc finger
	IPR007087	562	589	PS50157	Zinc finger
	IPR007087	904	931	PS50157	Zinc finger
	IPR007087	1042	1065	PS50157	Zinc finger
	IPR007087	1098	1125	PS50157	Zinc finger
	IPR007087	1160	1187	PS50157	Zinc finger
	IPR007087	1217	1244	PS50157	Zinc finger
	IPR007087	1267	1294	PS50157	Zinc finger
	IPR007087	1440	1463	PS50157	Zinc finger
	IPR007087	1499	1523	PS50157	Zinc finger
ScanRegExp	IPR007087	389	409	PS00028	Zinc finger
	IPR007087	442	462	PS00028	Zinc finger
	IPR007087	500	520	PS00028	Zinc finger
	IPR007087	564	584	PS00028	Zinc finger
	IPR007087	906	926	PS00028	Zinc finger
	IPR007087	1044	1064	PS00028	Zinc finger
	IPR007087	1100	1120	PS00028	Zinc finger
	IPR007087	1162	1182	PS00028	Zinc finger
	IPR007087	1219	1239	PS00028	Zinc finger
	IPR007087	1269	1289	PS00028	Zinc finger
	IPR007087	1442	1462	PS00028	Zinc finger
	IPR007087	1501	1521	PS00028	Zinc finger

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	GTGCATAATACATACCCAGAG
Primer_r	GTTAGCAGTAGTTGTTAGGTG
PCR product length	94 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles