Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK04567 |
---|---|
Accession No | AB002304 |
Description | capicua transcriptional repressor |
Clone name | hg00063 |
Vector information | |
cDNA sequence | DNA sequence (4964 bp) Predicted protein sequence (1451 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0306
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | NULL | 935 | 947 | PR01217 | NULL |
NULL | 969 | 981 | PR01217 | NULL | |
NULL | 989 | 1010 | PR01217 | NULL | |
NULL | 1042 | 1059 | PR01217 | NULL | |
NULL | 1068 | 1093 | PR01217 | NULL | |
HMMPfam | IPR000910 | 43 | 111 | PF00505 | HMG1/2 (high mobility group) box |
HMMSmart | IPR000910 | 42 | 112 | SM00398 | HMG1/2 (high mobility group) box |
ProfileScan | IPR000910 | 43 | 111 | PS50118 | HMG1/2 (high mobility group) box |
ScanRegExp | IPR002345 | 70 | 83 | PS00213 | Lipocalin |
RT-PCR |
---|
Primer_f | CAGAGGGGGTGAGGAGAAAAC |
---|---|
Primer_r | GCACCCCTTTTTTCCCCAGAG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | CCR |
---|---|
Primer_f | CAGAGGGGGTGAGGAGAAAAC |
Primer_r | GCACCCCTTTTTTCCCCAGAG |
PCR product length | 104 bp |
PCR conditions | 95 °C15 sec66 °C60 sec30 cycles |