Gene/Protein Characteristic Table for KIAA0306
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK04567
Accession No AB002304
Description capicua transcriptional repressor
Clone name hg00063
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4964 bp)
Predicted protein sequence (1451 aa)
Source Human adult brain
Rouge ID mKIAA0306 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4964 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 1451 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAK73515 0 100.0 capicua protein...
Homo sapiens
AAD11988 0 99.9 BC85722_1 [Homo...
Homo sapiens
EAW57121 0 99.9 capicua homolog...
Homo sapiens
Q96RK0 0 99.9 Protein capicua...
Homo sapiens
XP_001153776 0 99.6 capicua homolog...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB002307 1.3e-05 29.0 KIAA0309
AB040955 0.00013 26.0 KIAA1522
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan NULL 935 947 PR01217 NULL
NULL 969 981 PR01217 NULL
NULL 989 1010 PR01217 NULL
NULL 1042 1059 PR01217 NULL
NULL 1068 1093 PR01217 NULL
HMMPfam IPR000910 43 111 PF00505 HMG1/2 (high mobility group) box
HMMSmart IPR000910 42 112 SM00398 HMG1/2 (high mobility group) box
ProfileScan IPR000910 43 111 PS50118 HMG1/2 (high mobility group) box
ScanRegExp IPR002345 70 83 PS00213 Lipocalin
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f CAGAGGGGGTGAGGAGAAAAC
Primer_r GCACCCCTTTTTTCCCCAGAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 19
Experimental conditions
Panel name CCR
Primer_f CAGAGGGGGTGAGGAGAAAAC
Primer_r GCACCCCTTTTTTCCCCAGAG
PCR product length 104 bp
PCR conditions 95 °C15 sec66 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp