Gene/Protein Characteristic Table for KIAA0390
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00527
Accession No AB002388
Description zinc finger protein 536
Clone name hj00075
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4935 bp)
Predicted protein sequence (1312 aa)
Flexi ORF Clone FXC00527
Source Human adult brain
Rouge ID mKIAA0390 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4935 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 1312 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O15090 0 100.0 Zinc finger pro...
Homo sapiens
XP_512560 0 99.8 zinc finger pro...
Pan troglodytes
AAI50172 0 100.0 ZNF536 protein ...
Homo sapiens
XP_598505 0 92.6 similar to Zinc...
Bos taurus
XP_001488992 0 91.8 similar to Zinc...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
D86975 8.7e-30 38.3 KIAA0222
AB058777 4.9e-06 26.5 KIAA1874
AB037760 8.7e-06 29.2 KIAA1339
AB075836 4.2e-05 21.9 KIAA1956
AB040918 7.2e-05 23.1 KIAA1485
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 765 786 PD000003 Zinc finger
HMMPfam IPR007087 142 164 PF00096 Zinc finger
IPR007087 170 192 PF00096 Zinc finger
IPR007087 286 309 PF00096 Zinc finger
IPR007087 312 335 PF00096 Zinc finger
IPR007087 357 379 PF00096 Zinc finger
IPR007087 385 407 PF00096 Zinc finger
IPR007087 643 665 PF00096 Zinc finger
IPR007087 763 785 PF00096 Zinc finger
IPR007087 791 813 PF00096 Zinc finger
HMMSmart IPR015880 142 164 SM00355 Zinc finger
IPR015880 170 192 SM00355 Zinc finger
IPR015880 286 309 SM00355 Zinc finger
IPR015880 312 335 SM00355 Zinc finger
IPR015880 357 379 SM00355 Zinc finger
IPR015880 385 407 SM00355 Zinc finger
IPR015880 643 665 SM00355 Zinc finger
IPR015880 763 785 SM00355 Zinc finger
IPR015880 791 813 SM00355 Zinc finger
IPR015880 1013 1036 SM00355 Zinc finger
ProfileScan IPR007087 142 169 PS50157 Zinc finger
IPR007087 170 192 PS50157 Zinc finger
IPR007087 286 314 PS50157 Zinc finger
IPR007087 357 384 PS50157 Zinc finger
IPR007087 385 412 PS50157 Zinc finger
IPR007087 643 670 PS50157 Zinc finger
IPR007087 763 790 PS50157 Zinc finger
IPR007087 791 818 PS50157 Zinc finger
ScanRegExp IPR007087 144 164 PS00028 Zinc finger
IPR007087 288 309 PS00028 Zinc finger
IPR007087 359 379 PS00028 Zinc finger
IPR007087 386 407 PS00028 Zinc finger
IPR007087 645 665 PS00028 Zinc finger
IPR007087 765 785 PS00028 Zinc finger
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f CAGCATACAGCACACTTAAAG
Primer_r GTGCTTTGGAACAGAGTATTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 19
Experimental conditions
Panel name GeneBridge 4
Primer_f CAGCATACAGCACACTTAAAG
Primer_r GTGCTTTGGAACAGAGTATTG
PCR product length 136 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp