KIAA1339

Product ID	ORK07466
Accession No	AB037760
Description	zinc finger protein 398
Clone name	fj00071
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4217 bp) Predicted protein sequence (409 aa)
Source	Human fetal brain

Length: 4217 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2987 bp
Genome contig ID	gi89161213f_148404531
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- TTGTGAAAATAAATGGAAGTTGGTTGATTGTCTAG
Flanking genome sequence (106289 - 106338)	----+--------+--------+--------+--------+----* AAAGTGCAAGAAGATGGCCCTGCTCCTTTTCTGCTGAACATTTAGTATTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	f	148504531	148510818	2	99.0	Perfect prediction

Length: 409 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAK92788	2e-163	100.0	zinc finger DNA...	Homo sapiens
BAF83188	2.6e-163	100.0	unnamed protein...	Homo sapiens
Q8TD17	2.6e-163	100.0	Zinc finger pro...	Homo sapiens
EAW80060	2.6e-163	100.0	zinc finger pro...	Homo sapiens
BAG63321	2.6e-163	100.0	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002324	2.9e-31	44.2	KIAA0326
AB075836	1e-30	43.8	KIAA1956
AB051497	2.9e-30	42.7	KIAA1710
AB040941	2.9e-29	43.5	KIAA1508
AB058755	3.1e-29	39.9	KIAA1852

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	278	301	PD000003	Zinc finger
BlastProDom	IPR007087	306	329	PD000003	Zinc finger
HMMPfam	IPR007087	165	187	PF00096	Zinc finger
	IPR007087	194	216	PF00096	Zinc finger
	IPR007087	222	244	PF00096	Zinc finger
	IPR007087	250	272	PF00096	Zinc finger
	IPR007087	278	300	PF00096	Zinc finger
	IPR007087	306	328	PF00096	Zinc finger
	IPR007087	334	357	PF00096	Zinc finger
HMMSmart	IPR015880	110	131	SM00355	Zinc finger
	IPR015880	165	187	SM00355	Zinc finger
	IPR015880	194	216	SM00355	Zinc finger
	IPR015880	222	244	SM00355	Zinc finger
	IPR015880	250	272	SM00355	Zinc finger
	IPR015880	278	300	SM00355	Zinc finger
	IPR015880	306	328	SM00355	Zinc finger
	IPR015880	334	357	SM00355	Zinc finger
ProfileScan	IPR007087	137	164	PS50157	Zinc finger
	IPR007087	165	192	PS50157	Zinc finger
	IPR007087	194	221	PS50157	Zinc finger
	IPR007087	222	249	PS50157	Zinc finger
	IPR007087	250	277	PS50157	Zinc finger
	IPR007087	278	305	PS50157	Zinc finger
	IPR007087	306	333	PS50157	Zinc finger
	IPR007087	334	359	PS50157	Zinc finger
ScanRegExp	IPR007087	167	187	PS00028	Zinc finger
	IPR007087	196	216	PS00028	Zinc finger
	IPR007087	224	244	PS00028	Zinc finger
	IPR007087	252	272	PS00028	Zinc finger
	IPR007087	280	300	PS00028	Zinc finger
	IPR007087	308	328	PS00028	Zinc finger
	IPR007087	336	357	PS00028	Zinc finger

Primer_f	GTGCGATACTAAGCCTCAGCC
Primer_r	CACTCTTTGGAACTGGCCTGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GTGCGATACTAAGCCTCAGCC
Primer_r	CACTCTTTGGAACTGGCCTGC
PCR product length	105 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles