KIAA1485

Product ID	ORK07417
Accession No	AB040918
Description	zinc finger and AT hook domain containing
Clone name	fj07037
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4006 bp) Predicted protein sequence (1104 aa)
Source	Human fetal brain

Length: 4006 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	690 bp
Genome contig ID	gi51511724r_135459217
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- GAGGTGAGGTGGTTGGAATAAAAACAGTTCCTGTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGAATGCTTTGGTTCTTCAGGCGGGATGGCTTACATTTCCCCTTCCCAAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	r	135559217	135718917	14	99.7	Perfect prediction

Length: 1104 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH25423	100.0	ZFAT protein [H...	Homo sapiens
BAD12568	100.0	ZFAT-2 [Homo sa...	Homo sapiens
Q9P243	100.0	Zinc finger pro...	Homo sapiens
BAD12567	100.0	ZFAT-1 [Homo sa...	Homo sapiens
BAG72872	100.0	zinc finger and...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051497	5.5e-14	30.7	KIAA1710
AB040941	7.6e-13	27.4	KIAA1508
AB037770	2.2e-12	22.4	KIAA1349
D31763	7.4e-12	27.0	KIAA0065
AB075827	1.1e-11	25.3	KIAA1947

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	132	154	PF00096	Zinc finger
	IPR007087	160	182	PF00096	Zinc finger
	IPR007087	265	287	PF00096	Zinc finger
	IPR007087	319	342	PF00096	Zinc finger
	IPR007087	603	625	PF00096	Zinc finger
	IPR007087	659	683	PF00096	Zinc finger
	IPR007087	691	714	PF00096	Zinc finger
	IPR007087	770	792	PF00096	Zinc finger
	IPR007087	798	820	PF00096	Zinc finger
	IPR007087	827	849	PF00096	Zinc finger
	IPR007087	902	925	PF00096	Zinc finger
HMMSmart	IPR015880	132	154	SM00355	Zinc finger
	IPR015880	160	182	SM00355	Zinc finger
	IPR015880	187	210	SM00355	Zinc finger
	IPR015880	215	238	SM00355	Zinc finger
	IPR015880	265	287	SM00355	Zinc finger
	IPR015880	293	315	SM00355	Zinc finger
	IPR015880	319	342	SM00355	Zinc finger
	IPR015880	603	625	SM00355	Zinc finger
	IPR015880	631	654	SM00355	Zinc finger
	IPR015880	659	683	SM00355	Zinc finger
	IPR015880	691	714	SM00355	Zinc finger
	IPR015880	741	764	SM00355	Zinc finger
	IPR015880	770	792	SM00355	Zinc finger
	IPR015880	798	820	SM00355	Zinc finger
	IPR015880	827	849	SM00355	Zinc finger
	IPR015880	855	878	SM00355	Zinc finger
	IPR015880	902	925	SM00355	Zinc finger
ProfileScan	IPR007087	132	159	PS50157	Zinc finger
	IPR007087	160	187	PS50157	Zinc finger
	IPR007087	215	243	PS50157	Zinc finger
	IPR007087	265	292	PS50157	Zinc finger
	IPR007087	293	315	PS50157	Zinc finger
	IPR007087	319	347	PS50157	Zinc finger
	IPR007087	603	630	PS50157	Zinc finger
	IPR007087	691	714	PS50157	Zinc finger
	IPR007087	770	797	PS50157	Zinc finger
	IPR007087	798	825	PS50157	Zinc finger
	IPR007087	827	854	PS50157	Zinc finger
	IPR007087	855	883	PS50157	Zinc finger
ScanRegExp	IPR007087	134	154	PS00028	Zinc finger
	IPR007087	189	210	PS00028	Zinc finger
	IPR007087	217	238	PS00028	Zinc finger
	IPR007087	267	287	PS00028	Zinc finger
	IPR007087	321	342	PS00028	Zinc finger
	IPR007087	605	625	PS00028	Zinc finger
	IPR007087	693	714	PS00028	Zinc finger
	IPR005829	719	734	PS00216	Sugar transporter superfamily
	IPR007087	800	820	PS00028	Zinc finger
	IPR007087	857	878	PS00028	Zinc finger
	IPR007087	904	925	PS00028	Zinc finger
	IPR000886	1101	1104	PS00014	Endoplasmic reticulum targeting sequence

Primer_f	GTACGGGTTTTTAATCACTGC
Primer_r	CTTAGAATGGGAGGCGAACAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-