Order Kazusa clone(s) from : ![]() |
Product ID | ORK07417 |
---|---|
Accession No | AB040918 |
Description | zinc finger and AT hook domain containing |
Clone name | fj07037 |
Vector information | |
cDNA sequence | DNA sequence (4006 bp) Predicted protein sequence (1104 aa) |
Source | Human fetal brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 690 bp |
---|---|
Genome contig ID | gi51511724r_135459217 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 8 | r | 135559217 | 135718917 | 14 | 99.7 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR007087 | 132 | 154 | PF00096 | Zinc finger |
IPR007087 | 160 | 182 | PF00096 | Zinc finger | |
IPR007087 | 265 | 287 | PF00096 | Zinc finger | |
IPR007087 | 319 | 342 | PF00096 | Zinc finger | |
IPR007087 | 603 | 625 | PF00096 | Zinc finger | |
IPR007087 | 659 | 683 | PF00096 | Zinc finger | |
IPR007087 | 691 | 714 | PF00096 | Zinc finger | |
IPR007087 | 770 | 792 | PF00096 | Zinc finger | |
IPR007087 | 798 | 820 | PF00096 | Zinc finger | |
IPR007087 | 827 | 849 | PF00096 | Zinc finger | |
IPR007087 | 902 | 925 | PF00096 | Zinc finger | |
HMMSmart | IPR015880 | 132 | 154 | SM00355 | Zinc finger |
IPR015880 | 160 | 182 | SM00355 | Zinc finger | |
IPR015880 | 187 | 210 | SM00355 | Zinc finger | |
IPR015880 | 215 | 238 | SM00355 | Zinc finger | |
IPR015880 | 265 | 287 | SM00355 | Zinc finger | |
IPR015880 | 293 | 315 | SM00355 | Zinc finger | |
IPR015880 | 319 | 342 | SM00355 | Zinc finger | |
IPR015880 | 603 | 625 | SM00355 | Zinc finger | |
IPR015880 | 631 | 654 | SM00355 | Zinc finger | |
IPR015880 | 659 | 683 | SM00355 | Zinc finger | |
IPR015880 | 691 | 714 | SM00355 | Zinc finger | |
IPR015880 | 741 | 764 | SM00355 | Zinc finger | |
IPR015880 | 770 | 792 | SM00355 | Zinc finger | |
IPR015880 | 798 | 820 | SM00355 | Zinc finger | |
IPR015880 | 827 | 849 | SM00355 | Zinc finger | |
IPR015880 | 855 | 878 | SM00355 | Zinc finger | |
IPR015880 | 902 | 925 | SM00355 | Zinc finger | |
ProfileScan | IPR007087 | 132 | 159 | PS50157 | Zinc finger |
IPR007087 | 160 | 187 | PS50157 | Zinc finger | |
IPR007087 | 215 | 243 | PS50157 | Zinc finger | |
IPR007087 | 265 | 292 | PS50157 | Zinc finger | |
IPR007087 | 293 | 315 | PS50157 | Zinc finger | |
IPR007087 | 319 | 347 | PS50157 | Zinc finger | |
IPR007087 | 603 | 630 | PS50157 | Zinc finger | |
IPR007087 | 691 | 714 | PS50157 | Zinc finger | |
IPR007087 | 770 | 797 | PS50157 | Zinc finger | |
IPR007087 | 798 | 825 | PS50157 | Zinc finger | |
IPR007087 | 827 | 854 | PS50157 | Zinc finger | |
IPR007087 | 855 | 883 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 134 | 154 | PS00028 | Zinc finger |
IPR007087 | 189 | 210 | PS00028 | Zinc finger | |
IPR007087 | 217 | 238 | PS00028 | Zinc finger | |
IPR007087 | 267 | 287 | PS00028 | Zinc finger | |
IPR007087 | 321 | 342 | PS00028 | Zinc finger | |
IPR007087 | 605 | 625 | PS00028 | Zinc finger | |
IPR007087 | 693 | 714 | PS00028 | Zinc finger | |
IPR005829 | 719 | 734 | PS00216 | Sugar transporter superfamily | |
IPR007087 | 800 | 820 | PS00028 | Zinc finger | |
IPR007087 | 857 | 878 | PS00028 | Zinc finger | |
IPR007087 | 904 | 925 | PS00028 | Zinc finger | |
IPR000886 | 1101 | 1104 | PS00014 | Endoplasmic reticulum targeting sequence |
![]() |
Primer_f | GTACGGGTTTTTAATCACTGC |
---|---|
Primer_r | CTTAGAATGGGAGGCGAACAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |