Gene/Protein Characteristic Table for KIAA0465
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05604
Accession No AB007934
Description microtubule-actin crosslinking factor 1
Clone name hg01123s2
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (14491 bp)
Predicted protein sequence (4433 aa)
Source Human adult brain
Rouge ID mKIAA0465 by Kazusa Mouse cDNA Project
Note We replaced hg01123 and pf00419, former representative clones for KIAA0465 with hg01123s2. (2002/5/10,2003/8/28)
Features of the cloned cDNA sequence
Description

Length: 14491 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 1188 bp
Genome contig ID gi89161185f_39438573
PolyA signal sequence
(ATTAAA,-21)		 
+----*----+----*----+----*----+----
AGACACACTTTTGTATTAAAATTGCTTGCAGTAAC
Flanking genome sequence
(286670 - 286719)		 
----+----*----+----*----+----*----+----*----+----*
AAATATTTTGTATTTCCTGATTTTCTTTTCAACTATTACCTTATCTATAA

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 1 f 39538573 39725241 70 99.9 Perfect prediction
Features of the protein sequence
Description

Length: 4433 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
CAM20971 0 91.7 microtubule-act...
 Mus musculus
EDL30377 0 91.1 mCG1040588, iso...
 Mus musculus
CAM20969 0 91.0 microtubule-act...
 Mus musculus
CAM20970 0 79.2 microtubule-act...
 Mus musculus
Q9QXZ0 0 90.4 Microtubule-act...
 Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB033077 0 100.0 KIAA1251
AB018271 5.2e-172 67.1 KIAA0728
AB023228 1.1e-10 19.6 KIAA1011
AB033088 1.7e-06 19.4 KIAA1262
AB002334 0.0002 20.7 KIAA0336
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR002048 4095 4149 PD000012 Calcium-binding EF-hand
HMMPfam IPR002017 680 792 PF00435 Spectrin repeat
IPR002017 948 1024 PF00435 Spectrin repeat
IPR002017 1065 1175 PF00435 Spectrin repeat
IPR002017 1178 1284 PF00435 Spectrin repeat
IPR002017 1393 1507 PF00435 Spectrin repeat
IPR002017 1510 1619 PF00435 Spectrin repeat
IPR002017 1622 1730 PF00435 Spectrin repeat
IPR002017 1843 1950 PF00435 Spectrin repeat
IPR002017 1953 2057 PF00435 Spectrin repeat
IPR002017 2309 2386 PF00435 Spectrin repeat
IPR002017 2389 2495 PF00435 Spectrin repeat
IPR002017 2498 2604 PF00435 Spectrin repeat
IPR002017 2607 2713 PF00435 Spectrin repeat
IPR002017 2716 2822 PF00435 Spectrin repeat
IPR002017 2825 2930 PF00435 Spectrin repeat
IPR002017 2936 3046 PF00435 Spectrin repeat
IPR002017 3049 3155 PF00435 Spectrin repeat
IPR002017 3158 3265 PF00435 Spectrin repeat
IPR002017 3268 3374 PF00435 Spectrin repeat
IPR002017 3377 3484 PF00435 Spectrin repeat
IPR002017 3487 3593 PF00435 Spectrin repeat
IPR002017 3596 3703 PF00435 Spectrin repeat
IPR002017 3710 3811 PF00435 Spectrin repeat
IPR002017 3814 3920 PF00435 Spectrin repeat
IPR002017 3923 4057 PF00435 Spectrin repeat
IPR002048 4090 4118 PF00036 Calcium-binding EF-hand
IPR002048 4126 4154 PF00036 Calcium-binding EF-hand
IPR003108 4165 4237 PF02187 Growth-arrest-specific protein 2
HMMSmart IPR002017 411 540 SM00150 Spectrin repeat
IPR002017 558 666 SM00150 Spectrin repeat
IPR002017 683 791 SM00150 Spectrin repeat
IPR002017 951 1061 SM00150 Spectrin repeat
IPR002017 1068 1174 SM00150 Spectrin repeat
IPR002017 1181 1283 SM00150 Spectrin repeat
IPR002017 1290 1389 SM00150 Spectrin repeat
IPR002017 1396 1506 SM00150 Spectrin repeat
IPR002017 1513 1618 SM00150 Spectrin repeat
IPR002017 1625 1729 SM00150 Spectrin repeat
IPR002017 1736 1839 SM00150 Spectrin repeat
IPR002017 1846 1949 SM00150 Spectrin repeat
IPR002017 1956 2056 SM00150 Spectrin repeat
IPR002017 2172 2274 SM00150 Spectrin repeat
IPR002017 2281 2385 SM00150 Spectrin repeat
IPR002017 2392 2494 SM00150 Spectrin repeat
IPR002017 2501 2603 SM00150 Spectrin repeat
IPR002017 2610 2712 SM00150 Spectrin repeat
IPR002017 2719 2821 SM00150 Spectrin repeat
IPR002017 2828 2929 SM00150 Spectrin repeat
IPR002017 2939 3045 SM00150 Spectrin repeat
IPR002017 3052 3154 SM00150 Spectrin repeat
IPR002017 3161 3264 SM00150 Spectrin repeat
IPR002017 3271 3373 SM00150 Spectrin repeat
IPR002017 3380 3483 SM00150 Spectrin repeat
IPR002017 3490 3592 SM00150 Spectrin repeat
IPR002017 3599 3702 SM00150 Spectrin repeat
IPR002017 3709 3810 SM00150 Spectrin repeat
IPR002017 3817 3919 SM00150 Spectrin repeat
IPR002017 3926 4056 SM00150 Spectrin repeat
IPR002048 4090 4118 SM00054 Calcium-binding EF-hand
IPR002048 4126 4154 SM00054 Calcium-binding EF-hand
IPR003108 4165 4237 SM00243 Growth-arrest-specific protein 2
ProfileScan IPR002048 4086 4121 PS50222 Calcium-binding EF-hand
IPR002048 4122 4157 PS50222 Calcium-binding EF-hand
ScanRegExp IPR001547 2662 2671 PS00659 Glycoside hydrolase
IPR002048 4099 4111 PS00018 Calcium-binding EF-hand
IPR002048 4135 4147 PS00018 Calcium-binding EF-hand
Experimental conditions
Primer_f
Primer_r
PCR conditions °C sec °C sec cycles

RH mapping information
Description

Chromosome No. 1
Experimental conditions
Panel name GeneBridge 4
Primer_f CCTTTTCATGGTCACTTGGTC
Primer_r ACCAGCACACTTGTTAACCAG
PCR product length 85 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp