KIAA1262

Product ID	ORK05647
Accession No	AB033088
Description	spectrin repeat containing, nuclear envelope 1
Clone name	hh15990
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5683 bp) Predicted protein sequence (1362 aa)
Source	Human adult brain

Length: 5683 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1594 bp
Genome contig ID	gi89161210r_152578328
PolyA signal sequence (None)	+--------+--------+----*----+---- GCACTCCAGCCTGGGTGACAGTGAGACTCCATCTC
Flanking genome sequence (99722 - 99673)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAAGTTACTACTCTGGCCTGTTGGCTCCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	r	152678050	152696975	11	98.9	Perfect prediction

Length: 1362 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW47736	99.9	spectrin repeat...	Homo sapiens
AAN60442	99.9	nesprin-1 [Homo...	Homo sapiens
EAW47731	99.8	spectrin repeat...	Homo sapiens
EAW47727	99.8	spectrin repeat...	Homo sapiens
EAW47737	99.8	spectrin repeat...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023228	1.8e-15	29.2	KIAA1011
AB007934	1.6e-08	19.3	KIAA0465
AB018339	1.4e-07	19.6	KIAA0796
AB023166	6.2e-05	21.4	KIAA0949
AB018271	8e-05	20.2	KIAA0728

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002017	128	232	PF00435	Spectrin repeat
	IPR002017	235	341	PF00435	Spectrin repeat
	IPR002017	453	557	PF00435	Spectrin repeat
	IPR002017	666	772	PF00435	Spectrin repeat
	IPR002017	883	990	PF00435	Spectrin repeat
HMMSmart	IPR002017	129	231	SM00150	Spectrin repeat
	IPR002017	238	340	SM00150	Spectrin repeat
	IPR002017	347	449	SM00150	Spectrin repeat
	IPR002017	456	556	SM00150	Spectrin repeat
	IPR002017	669	771	SM00150	Spectrin repeat
	IPR002017	778	879	SM00150	Spectrin repeat
	IPR002017	886	989	SM00150	Spectrin repeat
	IPR002017	996	1101	SM00150	Spectrin repeat
	IPR002017	1210	1305	SM00150	Spectrin repeat

Primer_f	CAGAGCAAGCCATGAGTCCAC
Primer_r	CGTGACTGACAGAAAAGGAAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CAGAGCAAGCCATGAGTCCAC
Primer_r	CGTGACTGACAGAAAAGGAAC
PCR product length	94 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles