KIAA0796

Product ID	ORK05621
Accession No	AB018339
Description	spectrin repeat containing, nuclear envelope 1
Clone name	hk06116s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6289 bp) Predicted protein sequence (1876 aa)
Source	Human adult brain
Note	We replaced hk06116, former representative clones for KIAA0796 with hk06116s1. (2002/5/10)

Length: 6289 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	656 bp
Genome contig ID	gi89161210r_152384608
PolyA signal sequence (None)	+--------+--------+----*----+---- GAAGGCTTTATGTGAAAAAAGTTGAATGTTATAGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAGATATTTATGTATGTACAGTTTGCTAAAGCCAAGTTTTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	r	152484608	152595044	34	99.9	Perfect prediction

Length: 1876 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAX11976	99.9	spectrin repeat...	Homo sapiens
EAW47727	99.9	spectrin repeat...	Homo sapiens
EAW47739	99.9	spectrin repeat...	Homo sapiens
CAI42284	99.9	spectrin repeat...	Homo sapiens
Q8NF91	99.9	Nesprin-1; Nucl...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023228	4.6e-134	44.4	KIAA1011
AB018271	4.3e-09	20.3	KIAA0728
AB033088	4.1e-08	19.4	KIAA1262
AB033077	1.6e-05	19.7	KIAA1251
AB007934	9.4e-05	19.9	KIAA0465

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002017	101	206	PF00435	Spectrin repeat
	IPR002017	431	532	PF00435	Spectrin repeat
	IPR002017	535	639	PF00435	Spectrin repeat
	IPR002017	752	856	PF00435	Spectrin repeat
	IPR002017	859	961	PF00435	Spectrin repeat
	IPR002017	964	1075	PF00435	Spectrin repeat
	IPR002017	1078	1184	PF00435	Spectrin repeat
	IPR002017	1187	1291	PF00435	Spectrin repeat
	IPR002017	1519	1626	PF00435	Spectrin repeat
HMMSmart	IPR002017	104	205	SM00150	Spectrin repeat
	IPR002017	212	314	SM00150	Spectrin repeat
	IPR002017	328	427	SM00150	Spectrin repeat
	IPR002017	434	531	SM00150	Spectrin repeat
	IPR002017	538	638	SM00150	Spectrin repeat
	IPR002017	645	748	SM00150	Spectrin repeat
	IPR002017	755	855	SM00150	Spectrin repeat
	IPR002017	862	960	SM00150	Spectrin repeat
	IPR002017	967	1074	SM00150	Spectrin repeat
	IPR002017	1081	1183	SM00150	Spectrin repeat
	IPR002017	1190	1290	SM00150	Spectrin repeat
	IPR002017	1522	1625	SM00150	Spectrin repeat
ProfileScan	IPR012315	1817	1876	PS51049	Klarsicht/ANC-1/syne-1 homology

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1821	FRVLRAALPLQLLLLLLIGLACL	1843	PRIMARY	23

Primer_f	CAATCTACCAACCAACCAGTG
Primer_r	TAAAACATCATGCCCCAAAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-