KIAA1251

Product ID	ORK05904
Accession No	AB033077
Description	microtubule-actin crosslinking factor 1
Clone name	hh07943
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5304 bp) Predicted protein sequence (1483 aa)
Source	Human adult brain
Rouge ID	mKIAA1251 by Kazusa Mouse cDNA Project
Note	Please refer to "Gene/Protein Characteristic Table for KIAA0465" because the cDNA sequence of KIAA1251 is included in KIAA0465.

Length: 5304 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	851 bp
Genome contig ID	gi89161185f_39438573
PolyA signal sequence (None)	+--------+--------+----*----+---- CCTGGGCAACAGACAGAGTGAGACTCCATCTCAGG
Flanking genome sequence (173161 - 173210)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAAAAAAGTTGGGAAAGCCTGGGTAGGTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	39538573	39611732	26	99.8	Perfect prediction

Length: 1483 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX07275	100.0	microtubule-act...	Homo sapiens
EAX07277	100.0	microtubule-act...	Homo sapiens
EAX07274	100.0	microtubule-act...	Homo sapiens
EAX07282	100.0	microtubule-act...	Homo sapiens
Q9UPN3	100.0	Microtubule-act...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007934	0	100.0	KIAA0465
AB018271	1.5e-05	20.4	KIAA0728
AB020673	0.00015	20.8	KIAA0866
AB018339	0.00019	19.2	KIAA0796

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002017	680	792	PF00435	Spectrin repeat
	IPR002017	948	1024	PF00435	Spectrin repeat
	IPR002017	1065	1175	PF00435	Spectrin repeat
	IPR002017	1178	1284	PF00435	Spectrin repeat
HMMSmart	IPR002017	411	540	SM00150	Spectrin repeat
	IPR002017	558	666	SM00150	Spectrin repeat
	IPR002017	683	791	SM00150	Spectrin repeat
	IPR002017	951	1061	SM00150	Spectrin repeat
	IPR002017	1068	1174	SM00150	Spectrin repeat
	IPR002017	1181	1283	SM00150	Spectrin repeat
	IPR002017	1290	1389	SM00150	Spectrin repeat

Primer_f	TGATTCCCAAGGCAAGACAGG
Primer_r	TAGCAAAAGGGGTGACAGGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TGATTCCCAAGGCAAGACAGG
Primer_r	TAGCAAAAGGGGTGACAGGTC
PCR product length	187 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles