|
Order Kazusa clone(s) from : |
| Product ID | ORK00088 |
|---|---|
| Accession No | AB007950 |
| Description | transmembrane and coiled-coil domain family 2, transcript variant 1 |
| Clone name | hm00132 |
| Vector information | |
| cDNA sequence | DNA sequence (3998 bp) Predicted protein sequence (732 aa) |
|
HaloTag ORF Clone |
FHC00088
|
| Flexi ORF Clone | FXC00088 |
| Source | Human adult brain |
| Rouge ID |
mKIAA0481
by Kazusa Mouse cDNA Project
|
| Note | We replaced hh01480 and hh01480s1, former representative clones for KIAA0481 with hm00132. (2002/5/10,2005/08/06) |
Length: 3998 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 1213 bp |
|---|---|
| Genome contig ID | gi89161185f_203363661 |
| PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (145429 - 145478) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 1 | f | 203463661 | 203509088 | 5 | 99.6 | Perfect prediction |
Length: 732 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Prediction of transmembrane (TM) segments| Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 667 | GKFINVILALMAVLLVFVSTIAN | 689 | PRIMARY | 23 | 2 | 705 | TLLVLVLFLLWKHWDSLTYLLEH | 727 | SECONDARY | 23 |
|---|
Experimental conditions| Primer_f | |
|---|---|
| Primer_r | |
| PCR conditions | °C sec °C sec cycles![]() |
Chromosome No. 1
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | CTCAGGAAGGTGCACAACAGC |
| Primer_r | GCTCTGGAGTGTTGTGTATGG |
| PCR product length | 146 bp |
| PCR conditions | 95 °C 15 sec 66 °C 60 sec 30 cycles |