Order Kazusa clone(s) from : ![]() |
Product ID | ORK07129 |
---|---|
Accession No | AB018322 |
Description | transmembrane and coiled-coil domain family 1 |
Clone name | hk05356 |
Vector information | |
cDNA sequence | DNA sequence (3743 bp) Predicted protein sequence (320 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0779
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | NULL | 123 | 186 | PD068654 | NULL |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 257 | INILLAVMAVLLVFVSTVANCVV | 279 | PRIMARY | 23 | 2 | 287 | RTFSTLFLVVFIAFLWKHWDALF | 309 | SECONDARY | 23 |
---|
![]() |
Primer_f | CAGTAATGGCTTTCTTGTCCC |
---|---|
Primer_r | AGAGCGAGGTTATAGAAGAGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |