Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK07129 |
---|---|
Accession No | AB018322 |
Description | transmembrane and coiled-coil domain family 1 |
Clone name | hk05356 |
Vector information | |
cDNA sequence | DNA sequence (3743 bp) Predicted protein sequence (320 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0779
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | NULL | 123 | 186 | PD068654 | NULL |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 257 | INILLAVMAVLLVFVSTVANCVV | 279 | PRIMARY | 23 | 2 | 287 | RTFSTLFLVVFIAFLWKHWDALF | 309 | SECONDARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | CAGTAATGGCTTTCTTGTCCC |
---|---|
Primer_r | AGAGCGAGGTTATAGAAGAGC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |