KIAA1145

Product ID	ORK00187
Accession No	AB032971
Description	transmembrane and coiled-coil domain family 3, transcript variant 2
Clone name	hk10430
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4361 bp) Predicted protein sequence (467 aa)
HaloTag ORF Clone	FHC00187
Flexi ORF Clone	FXC00187
Source	Human adult brain

Length: 4361 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2866 bp
Genome contig ID	gi89161190r_93386476
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- AGAAATATTACAATTAAAAATAGTGATGTAGCTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACATATGCTGGAATTGGATATTTAATTTATGTTTGTGTCAACTATAATC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	r	93486476	93533968	4	99.1	Perfect prediction

Length: 467 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW97510	3.6e-157	97.6	transmembrane a...	Homo sapiens
Q9ULS5	1.5e-156	97.4	Transmembrane a...	Homo sapiens
CAH90408	6.4e-156	96.6	hypothetical pr...	Pongo abelii
EAW97512	4.9e-155	100.0	transmembrane a...	Homo sapiens
EDM16881	1.5e-149	92.7	transmembrane a...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007950	5.3e-61	55.7	KIAA0481
AB018322	1.8e-34	53.3	KIAA0779

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	399	VLLGRCINVILAFMTVILVCVST	421	PRIMARY	23
SOSUI2	2	433	RCHILGTFFAVTLLAIFCKNWDH	455	PRIMARY	23

Primer_f	CGTAGGCTTCATTTTCACACC
Primer_r	CTTCTCTACTTCTGTCACTGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-