Gene/Protein Characteristic Table for KIAA0521
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01977
Accession No AB011093
Description Rho/Rac guanine nucleotide exchange factor (GEF) 18, transcript variant 1
Clone name hg01387
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5113 bp)
Predicted protein sequence (1050 aa)
Flexi ORF Clone FXC01977
Source Human adult brain
Rouge ID mKIAA0521 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5113 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning Warning
Features of the protein sequence
Description

Length: 1050 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q6ZSZ5 0 100.0 Rho guanine nuc...
Homo sapiens
NP_001124427 0 99.8 Rho-specific gu...
Homo sapiens
BAC86801 0 99.6 unnamed protein...
Homo sapiens
EAW69039 0 100.0 hCG22253, isofo...
Homo sapiens
NP_056133 0 99.8 Rho-specific gu...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB014551 5.7e-31 37.2 KIAA0651
AB002378 2.6e-08 26.6 KIAA0380
AB002380 7.1e-08 27.6 KIAA0382
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000219 140 332 PF00621 DH
IPR001849 374 475 PF00169 Pleckstrin-like
HMMSmart IPR000219 140 332 SM00325 DH
IPR001849 374 477 SM00233 Pleckstrin-like
ProfileScan IPR000219 136 333 PS50010 DH
IPR001849 373 475 PS50003 Pleckstrin-like
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f CATCTCGGACACGTTTATTGC
Primer_r TCTTTGTCAGTTGTGGTCATG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 19
Experimental conditions
Panel name GeneBridge 4
Primer_f CATCTCGGACACGTTTATTGC
Primer_r TCTTTGTCAGTTGTGGTCATG
PCR product length 137 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp