KIAA0382

Product ID	ORK04163
Accession No	AB002380
Description	Rho guanine nucleotide exchange factor (GEF) 12
Clone name	ef00443
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (8283 bp) Predicted protein sequence (1443 aa)
Source
Rouge ID	mKIAA0382 by Kazusa Mouse cDNA Project
Note	We replaced hh00685, former representative clones for KIAA0382 with ef00443. (2005/08/06)

Length: 8283 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	3951 bp
Genome contig ID	gi51511727f_119697727
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- AAAATAAGATTTCAAATATTAAATAAGCTTAAAGG
Flanking genome sequence (167222 - 167271)	----+--------+--------+--------+--------+----* AACCAAGCATGTGACTTTTTATTTGTATTCTGGTTGATTTGTCTTGTCCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	f	119797727	119864947	36	99.5	Perfect prediction

Length: 1443 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9NZN5	100.0	Rho guanine nuc...	Homo sapiens
XP_001166795	99.9	Rho guanine nuc...	Pan troglodytes
XP_001166830	99.9	Rho guanine nuc...	Pan troglodytes
XP_508820	99.9	Rho guanine nuc...	Pan troglodytes
XP_001917643	92.5	similar to guan...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002378	5.3e-64	32.6	KIAA0380
AB014551	2e-16	25.5	KIAA0651
AB018263	1.4e-15	23.4	KIAA0720
AB011093	1.7e-15	28.0	KIAA0521
AB033082	3.8e-13	28.8	KIAA1256

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001478	1	44	PF00595	PDZ/DHR/GLGF
	IPR015212	267	457	PF09128	Regulator of G protein signalling-like domain
	IPR000219	690	875	PF00621	DH
HMMSmart	IPR000219	690	875	SM00325	DH
HMMSmart	IPR001849	919	1033	SM00233	Pleckstrin-like
ProfileScan	IPR001478	1	35	PS50106	PDZ/DHR/GLGF
	IPR000219	686	876	PS50010	DH
	IPR001849	918	1031	PS50003	Pleckstrin-like
ScanRegExp	IPR001331	825	850	PS00741	Guanine-nucleotide dissociation stimulator

Primer_f	GTGTTCTATCAGCGAGTATCC
Primer_r	GTCAGCAAATCTTCCCCAATC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GTGTTCTATCAGCGAGTATCC
Primer_r	GTCAGCAAATCTTCCCCAATC
PCR product length	176 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles