Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00522 |
---|---|
Accession No | AB002378 |
Description | Rho guanine nucleotide exchange factor (GEF) 11, transcript variant 1 |
Clone name | hh00518 |
Vector information | |
cDNA sequence | DNA sequence (5790 bp) Predicted protein sequence (1539 aa) |
HaloTag ORF Clone |
FHC00522
|
Flexi ORF Clone | FXC00522 |
Source | Human adult brain |
Rouge ID |
mKIAA0380
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001478 | 64 | 137 | PF00595 | PDZ/DHR/GLGF |
IPR015212 | 324 | 503 | PF09128 | Regulator of G protein signalling-like domain | |
IPR000219 | 755 | 939 | PF00621 | DH | |
HMMSmart | IPR001478 | 72 | 140 | SM00228 | PDZ/DHR/GLGF |
IPR000342 | 330 | 449 | SM00315 | Regulator of G protein signalling | |
IPR000219 | 755 | 939 | SM00325 | DH | |
IPR001849 | 983 | 1098 | SM00233 | Pleckstrin-like | |
ProfileScan | IPR001478 | 64 | 128 | PS50106 | PDZ/DHR/GLGF |
IPR000342 | 330 | 436 | PS50132 | Regulator of G protein signalling | |
IPR000219 | 751 | 940 | PS50010 | DH | |
IPR001849 | 982 | 1096 | PS50003 | Pleckstrin-like |
RT-PCR |
---|
Primer_f | GGAAACCAAAGTGACAAAGAG |
---|---|
Primer_r | CAGACATGCAAGTGAAAGGAG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GGAAACCAAAGTGACAAAGAG |
Primer_r | CAGACATGCAAGTGAAAGGAG |
PCR product length | 121 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |