Gene/Protein Characteristic Table for KIAA0380
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00522
Accession No AB002378
Description Rho guanine nucleotide exchange factor (GEF) 11, transcript variant 1
Clone name hh00518
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5790 bp)
Predicted protein sequence (1539 aa)
Flexi ORF Clone FXC00522
Source Human adult brain
Rouge ID mKIAA0380 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5790 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 1539 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O15085 0 100.0 Rho guanine nuc...
Homo sapiens
EAW52893 0 99.9 Rho guanine nuc...
Homo sapiens
XP_001167782 0 99.5 Rho guanine nuc...
Pan troglodytes
XP_001116835 0 97.8 Rho guanine nuc...
Macaca mulatta
AAH57394 0 97.4 Rho guanine nuc...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB002380 7.5e-44 32.5 KIAA0382
AB014551 4.4e-11 24.9 KIAA0651
AB011093 1.8e-10 26.8 KIAA0521
AB033082 2.1e-07 26.9 KIAA1256
AB018263 2.3e-07 24.1 KIAA0720
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001478 64 137 PF00595 PDZ/DHR/GLGF
IPR015212 324 503 PF09128 Regulator of G protein signalling-like domain
IPR000219 755 939 PF00621 DH
HMMSmart IPR001478 72 140 SM00228 PDZ/DHR/GLGF
IPR000342 330 449 SM00315 Regulator of G protein signalling
IPR000219 755 939 SM00325 DH
IPR001849 983 1098 SM00233 Pleckstrin-like
ProfileScan IPR001478 64 128 PS50106 PDZ/DHR/GLGF
IPR000342 330 436 PS50132 Regulator of G protein signalling
IPR000219 751 940 PS50010 DH
IPR001849 982 1096 PS50003 Pleckstrin-like
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f GGAAACCAAAGTGACAAAGAG
Primer_r CAGACATGCAAGTGAAAGGAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 1
Experimental conditions
Panel name GeneBridge 4
Primer_f GGAAACCAAAGTGACAAAGAG
Primer_r CAGACATGCAAGTGAAAGGAG
PCR product length 121 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp