KIAA0720

Product ID	ORK01114
Accession No	AB018263
Description	pleckstrin homology domain containing, family G (with RhoGef domain) member 5, transcript variant 3
Clone name	hk01741s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4749 bp) Predicted protein sequence (1091 aa)
HaloTag ORF Clone	FHC01114
Flexi ORF Clone	FXC01114
Source	Human adult brain
Rouge ID	mKIAA0720 by Kazusa Mouse cDNA Project
Note	We replaced hk01741, former representative clones for KIAA0720 with hk01741s1. (1999/6/16)

Length: 4749 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1471 bp
Genome contig ID	gi89161185r_6348739
PolyA signal sequence (None)	+--------+--------+----*----+---- GGGCGCCCGTCGGAGGGCTATGGAGCAGCGGCCGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GGGGCTGCGCGGCGGTGGCGGCGGTGAGTTGAGACGCAGGAGGCTAGGGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	6448739	6480059	22	100.0	Perfect prediction

Length: 1091 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAI16069	99.2	pleckstrin homo...	Homo sapiens
BAG11230	100.0	pleckstrin homo...	synthetic construct
O94827	99.9	Pleckstrin homo...	Homo sapiens
BAG53269	99.0	unnamed protein...	Homo sapiens
BAH11909	99.3	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002380	2e-09	23.8	KIAA0382
AB002378	6.5e-07	24.3	KIAA0380

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000219	425	612	PF00621	DH
HMMPfam	IPR001849	670	769	PF00169	Pleckstrin-like
HMMSmart	IPR000219	425	612	SM00325	DH
HMMSmart	IPR001849	670	771	SM00233	Pleckstrin-like
ProfileScan	IPR000219	421	613	PS50010	DH
ProfileScan	IPR001849	669	769	PS50003	Pleckstrin-like

Primer_f	CCCTGGCTCTACCTTGAAGTG
Primer_r	GACAGGCCAAGTAGAACACGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CCCTGGCTCTACCTTGAAGTG
Primer_r	GACAGGCCAAGTAGAACACGC
PCR product length	130 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles