Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK04232 |
---|---|
Accession No | AB011120 |
Description | attractin |
Clone name | hh00769 |
Vector information | |
cDNA sequence | DNA sequence (5632 bp) Predicted protein sequence (452 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0548
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR002165 | 9 | 84 | PF01437 | Plexin |
IPR002049 | 86 | 129 | PF00053 | EGF-like | |
IPR002049 | 132 | 178 | PF00053 | EGF-like | |
HMMSmart | IPR003659 | 9 | 84 | SM00423 | Plexin/semaphorin/integrin |
IPR002049 | 86 | 129 | SM00180 | EGF-like | |
IPR002049 | 132 | 178 | SM00180 | EGF-like | |
ProfileScan | IPR002049 | 86 | 131 | PS50027 | EGF-like |
IPR002049 | 132 | 180 | PS50027 | EGF-like | |
ScanRegExp | IPR002049 | 100 | 134 | PS01248 | EGF-like |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 273 | NITFFVYVSNFTWPIKIQIAFSQ | 295 | SECONDARY | 23 | 2 | 301 | DLVQFFVTFFSCFLSLLLVAAVV | 323 | PRIMARY | 23 |
---|
RT-PCR |
---|
Primer_f | AAATGCACAGACCTCCCTTAG |
---|---|
Primer_r | ATTTCATTGCGGGGATTGTGG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AAATGCACAGACCTCCCTTAG |
Primer_r | ATTTCATTGCGGGGATTGTGG |
PCR product length | 126 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |