KIAA0534

Product ID	ORK04233
Accession No	AB011106
Description	attractin-like 1
Clone name	hg03820s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7302 bp) Predicted protein sequence (1028 aa)
Source	Human adult brain
Rouge ID	mKIAA0534 by Kazusa Mouse cDNA Project
Note	We replaced hg03820, former representative clones for KIAA0534 with hg03820s1. (2002/5/10)

Length: 7302 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	4215 bp
Genome contig ID	gi89161187f_116815357
PolyA signal sequence (AATAAA,-30)	+--------+--------+----*----+---- TATTAAATAAAAACATTGGCTCTTCCAACCCCCAC
Flanking genome sequence (883138 - 883187)	----+--------+--------+--------+--------+----* TGCCAAATGCAGTTTTGTTTTGTTTTTGTTTGTGTTTTATCCTTTCGTGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	116915357	117698493	20	99.3	Internal No-hit

Length: 1028 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAC86914	100.0	unnamed protein...	Homo sapiens
EAW49461	100.0	attractin-like ...	Homo sapiens
Q5VV63	99.9	Attractin-like ...	Homo sapiens
XP_001916550	98.0	similar to attr...	Equus caballus
XP_001787595	97.6	similar to attr...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011120	1.7e-106	68.0	KIAA0548
AB011541	4.8e-14	22.4	KIAA0817
D63483	7.6e-07	26.1	KIAA0149
AB011105	2.8e-06	29.2	KIAA0533
AB011539	7.8e-06	23.9	KIAA0815

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011498	3	51	PF07646	Kelch repeat type 2
	IPR006652	115	167	PF01344	Kelch repeat type 1
	IPR006652	169	223	PF01344	Kelch repeat type 1
	IPR006652	229	261	PF01344	Kelch repeat type 1
	IPR002165	315	358	PF01437	Plexin
	IPR002165	364	409	PF01437	Plexin
	IPR001304	414	523	PF00059	C-type lectin
	IPR002165	538	588	PF01437	Plexin
	IPR002165	591	661	PF01437	Plexin
	IPR002049	663	706	PF00053	EGF-like
	IPR002049	709	755	PF00053	EGF-like
HMMSmart	IPR003659	263	306	SM00423	Plexin/semaphorin/integrin
	IPR003659	315	358	SM00423	Plexin/semaphorin/integrin
	IPR003659	364	409	SM00423	Plexin/semaphorin/integrin
	IPR001304	397	522	SM00034	C-type lectin
	IPR003659	538	588	SM00423	Plexin/semaphorin/integrin
	IPR003659	591	661	SM00423	Plexin/semaphorin/integrin
	IPR002049	663	706	SM00180	EGF-like
	IPR002049	709	755	SM00180	EGF-like
ProfileScan	IPR001304	404	522	PS50041	C-type lectin
	IPR002049	663	708	PS50027	EGF-like
	IPR002049	709	757	PS50027	EGF-like
ScanRegExp	IPR002049	677	711	PS01248	EGF-like

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	878	DLVQFFVTFFSCFLSLLLVAAVV	900	PRIMARY	23

Primer_f	CAAGGAATACAAGCCATCTGG
Primer_r	GAACACTGGCATGCACACCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CAAGGAATACAAGCCATCTGG
Primer_r	GAACACTGGCATGCACACCTG
PCR product length	156 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles