KIAA0662

Product ID	ORK00596
Accession No	AB014562
Description	PHD finger protein 2
Clone name	hk01953s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5253 bp) Predicted protein sequence (1114 aa)
HaloTag ORF Clone	FHC00596
Flexi ORF Clone	FXC00596
Source	Human adult brain
Rouge ID	mKIAA0662 by Kazusa Mouse cDNA Project
Note	We replaced hk01953, former representative clones for KIAA0662 with hk01953s1. (2002/5/10)

Length: 5253 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	1907 bp
Genome contig ID	gi89161216f_95278853
PolyA signal sequence (AGTAAA,-25)	+--------+--------+----*----+---- GTTTTAAAAAAGTAAAAATATTTCAGGTTTTGTAC
Flanking genome sequence (202835 - 202884)	----+--------+--------+--------+--------+----* AGAACCATGTCTGTGTCATTTCTGCCTCGACTGTAGTTGTTCACCCTGGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	f	95378853	95481686	22	99.3	Both No-hit

Length: 1114 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09802	100.0	PHD finger prot...	synthetic construct
CAD38938	97.8	hypothetical pr...	Homo sapiens
O75151	97.4	PHD finger prot...	Homo sapiens
EAW62868	97.3	PHD finger prot...	Homo sapiens
EAW62869	99.3	PHD finger prot...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029034	6.5e-46	46.2	KIAA1111
AB023221	7.1e-10	33.1	KIAA1004

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013129	249	349	PF02373	Transcription factor jumonji
HMMSmart	IPR003347	210	366	SM00558	Transcription factor jumonji/aspartyl beta-hydroxylase
ProfileScan	IPR003347	210	366	PS51184	Transcription factor jumonji/aspartyl beta-hydroxylase

Primer_f	CTTACGGTCGGCACTTCTCTG
Primer_r	AGAAACAAATCCAGCCCCTCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CTTACGGTCGGCACTTCTCTG
Primer_r	AGAAACAAATCCAGCCCCTCC
PCR product length	110 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles