KIAA1004

Product ID	ORK00712
Accession No	AB023221
Description	lysine (K)-specific demethylase 2A, transcript variant 1
Clone name	hj01244
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4966 bp) Predicted protein sequence (1163 aa)
HaloTag ORF Clone	FHC00712
Flexi ORF Clone	FXC00712
Source	Human adult brain
Rouge ID	mKIAA1004 by Kazusa Mouse cDNA Project
Note	We replaced hk10034, former representative clones for KIAA1004 with hj01244. (2002/5/10)

Length: 4966 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1296 bp
Genome contig ID	gi51511727f_66543999
PolyA signal sequence (None)	+--------+--------+----*----+---- CTCTCTCTAGGGCAGCAGAGAGCTTTTTGCACTTT
Flanking genome sequence (236401 - 236450)	----+--------+--------+--------+--------+----* AAAAAAAAAAAGAAAGAAAGAAAGGTCGGAATTTCTTTTGGGTCAATATT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	f	66643999	66780398	21	100.0	Perfect prediction

Length: 1163 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y2K7	100.0	JmjC domain-con...	Homo sapiens
XP_540823	99.5	similar to F-bo...	Canis lupus fam...
XP_001107511	99.6	similar to F-bo...	Macaca mulatta
XP_001172815	99.5	F-box and leuci...	Pan troglodytes
XP_865140	99.4	similar to F-bo...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029034	1.7e-20	39.4	KIAA1111
AB014562	9.2e-16	33.0	KIAA0662

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013129	200	300	PF02373	Transcription factor jumonji
	IPR002857	564	610	PF02008	Zinc finger
	IPR001810	889	936	PF00646	Cyclin-like F-box
	IPR001611	1121	1145	PF00560	Leucine-rich repeat
HMMSmart	IPR003347	149	317	SM00558	Transcription factor jumonji/aspartyl beta-hydroxylase
	IPR001965	620	677	SM00249	Zinc finger
	IPR006553	1001	1026	SM00367	Leucine-rich repeat
	IPR006553	1064	1092	SM00367	Leucine-rich repeat
	IPR006553	1096	1119	SM00367	Leucine-rich repeat
ProfileScan	IPR003347	149	317	PS51184	Transcription factor jumonji/aspartyl beta-hydroxylase
	IPR002857	565	611	PS51058	Zinc finger
	IPR001965	618	679	PS50016	Zinc finger
ScanRegExp	IPR006058	578	586	PS00197	2Fe-2S ferredoxin
ScanRegExp	IPR001965	621	676	PS01359	Zinc finger

Primer_f	TGATCTTCGGTGGGCAGTAGG
Primer_r	GCTTGCTGCGATTGTCCTGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-