Order Kazusa clone(s) from : ![]() |
Product ID | ORK00114 |
---|---|
Accession No | AB014582 |
Description | RNA binding motif protein 19, transcript variant 2 |
Clone name | hk02879 |
Vector information | |
cDNA sequence | DNA sequence (4422 bp) Predicted protein sequence (973 aa) |
Flexi ORF Clone | FXC00114 |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1460 bp |
---|---|
Genome contig ID | gi89161190r_112638930 |
PolyA signal sequence (AATAAA,-16) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 12 | r | 112738930 | 112888494 | 25 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000504 | 17 | 87 | PF00076 | RNA recognition motif |
IPR000504 | 309 | 377 | PF00076 | RNA recognition motif | |
IPR000504 | 417 | 488 | PF00076 | RNA recognition motif | |
IPR000504 | 745 | 819 | PF00076 | RNA recognition motif | |
IPR000504 | 847 | 920 | PF00076 | RNA recognition motif | |
HMMSmart | IPR000504 | 16 | 88 | SM00360 | RNA recognition motif |
IPR000504 | 308 | 378 | SM00360 | RNA recognition motif | |
IPR003954 | 416 | 489 | SM00361 | RNA recognition | |
IPR000504 | 416 | 489 | SM00360 | RNA recognition motif | |
IPR000504 | 601 | 668 | SM00360 | RNA recognition motif | |
IPR003954 | 744 | 820 | SM00361 | RNA recognition | |
IPR000504 | 744 | 820 | SM00360 | RNA recognition motif | |
IPR000504 | 846 | 921 | SM00360 | RNA recognition motif | |
ProfileScan | IPR000504 | 15 | 92 | PS50102 | RNA recognition motif |
IPR000504 | 307 | 382 | PS50102 | RNA recognition motif | |
IPR000504 | 415 | 493 | PS50102 | RNA recognition motif | |
IPR000504 | 600 | 672 | PS50102 | RNA recognition motif | |
IPR000504 | 743 | 824 | PS50102 | RNA recognition motif | |
IPR000504 | 845 | 925 | PS50102 | RNA recognition motif |
![]() |
---|
![]() |
Primer_f | TGCCAGTCAAACGTTCAAAGG |
---|---|
Primer_r | AAGAGAAGTGGGTGGAAAAGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TGCCAGTCAAACGTTCAAAGG |
Primer_r | AAGAGAAGTGGGTGGAAAAGC |
PCR product length | 167 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |