KIAA0717

Product ID	ORK00611
Accession No	AB018260
Description	Rho-related BTB domain containing 2, transcript variant 3
Clone name	fh19258
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5449 bp) Predicted protein sequence (751 aa)
HaloTag ORF Clone	FHC00611
Flexi ORF Clone	FXC00611
Source	Human fetal brain
Rouge ID	mKIAA0717 by Kazusa Mouse cDNA Project
Note	We replaced hj03868, former representative clones for KIAA0717 with fh19258. (2001/5/29)

Length: 5449 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2728 bp
Genome contig ID	gi51511724f_22813106
PolyA signal sequence (CATAAA,-26)	+--------+--------+----*----+---- TCATGGATTCATAAATACATAAGTATTTTGTACAC
Flanking genome sequence (120551 - 120600)	----+--------+--------+--------+--------+----* AATGTGCTTCCTTGTTTGTATTATAACACATTTCAAATAGGGACCTTTGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	f	22913037	22933655	10	99.3	Perfect prediction

Length: 751 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_519653	99.7	Rho-related BTB...	Pan troglodytes
Q9BYZ6	100.0	Rho-related BTB...	Homo sapiens
BAF85552	99.9	unnamed protein...	Homo sapiens
AAG61157	99.9	DBC2 [Homo sapi...	Homo sapiens
CAH91218	98.8	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018283	1.4e-69	68.0	KIAA0740
AB020685	7e-10	25.0	KIAA0878

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001806	39	60	PR00449	Ras GTPase
	IPR001806	95	117	PR00449	Ras GTPase
	IPR001806	155	168	PR00449	Ras GTPase
	IPR001806	209	231	PR00449	Ras GTPase
HMMPfam	IPR013753	124	233	PF00071	Ras
	IPR013069	284	496	PF00651	BTB/POZ
	IPR013069	514	622	PF00651	BTB/POZ
HMMSmart	IPR003577	36	234	SM00173	Ras small GTPase
	IPR003579	39	234	SM00175	Ras small GTPase
	IPR003578	41	234	SM00174	Ras small GTPase
	IPR000210	290	496	SM00225	BTB/POZ-like
	IPR000210	524	622	SM00225	BTB/POZ-like
HMMTigr	IPR005225	36	229	TIGR00231	Small GTP-binding protein domain
ProfileScan	IPR000210	290	466	PS50097	BTB/POZ-like
ProfileScan	IPR000210	524	591	PS50097	BTB/POZ-like

Primer_f	AGTCGGATTCAGGAAACACCC
Primer_r	TGAGTGACAGGAAACCAGGGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AGTCGGATTCAGGAAACACCC
Primer_r	TGAGTGACAGGAAACCAGGGC
PCR product length	104 bp
PCR conditions	95 °C15 sec66 °C60 sec32 cycles