KIAA0740

Product ID	ORK00122
Accession No	AB018283
Description	Rho-related BTB domain containing 1, transcript variant 1
Clone name	hk03989s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4388 bp) Predicted protein sequence (696 aa)
HaloTag ORF Clone	FHC00122
Flexi ORF Clone	FXC00122
Source	Human adult brain
Rouge ID	mKIAA0740 by Kazusa Mouse cDNA Project
Note	We replaced hk03989, former representative clones for KIAA0740 with hk03989s1. (2005/08/06)

Length: 4388 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2040 bp
Genome contig ID	gi89161187r_62199206
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TATTTCACAAAAAGCCAATAAAATTGTTTAGCTAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATGCCTCCAGTTTTGTTTTAAGGACAGACATCATATTGTGTGTGTGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	r	62299206	62373930	11	100.0	Perfect prediction

Length: 696 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_507810	99.4	Rho-related BTB...	Pan troglodytes
CAH91062	98.9	hypothetical pr...	Pongo abelii
XP_001094923	97.8	Rho-related BTB...	Macaca mulatta
XP_001503521	94.4	similar to Rho-...	Equus caballus
XP_546116	93.1	similar to Rho-...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018260	2.1e-87	68.0	KIAA0717
AB020685	5.7e-14	24.1	KIAA0878

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001806	15	36	PR00449	Ras GTPase
	IPR001806	71	93	PR00449	Ras GTPase
	IPR001806	131	144	PR00449	Ras GTPase
	IPR001806	185	207	PR00449	Ras GTPase
HMMPfam	IPR013753	100	209	PF00071	Ras
	IPR013069	260	457	PF00651	BTB/POZ
	IPR013069	475	583	PF00651	BTB/POZ
HMMSmart	IPR003577	12	210	SM00173	Ras small GTPase
	IPR003579	15	210	SM00175	Ras small GTPase
	IPR003578	17	210	SM00174	Ras small GTPase
	IPR000210	266	457	SM00225	BTB/POZ-like
	IPR000210	485	583	SM00225	BTB/POZ-like
HMMTigr	IPR005225	12	188	TIGR00231	Small GTP-binding protein domain
ProfileScan	IPR000210	266	427	PS50097	BTB/POZ-like
ProfileScan	IPR000210	485	552	PS50097	BTB/POZ-like

Primer_f	AGAAGTAGGCTAAGGCAGACC
Primer_r	TCAGAACGAACTCACAATAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-