Order Kazusa clone(s) from : ![]() |
Product ID | ORK00122 |
---|---|
Accession No | AB018283 |
Description | Rho-related BTB domain containing 1, transcript variant 1 |
Clone name | hk03989s1 |
Vector information | |
cDNA sequence | DNA sequence (4388 bp) Predicted protein sequence (696 aa) |
Flexi ORF Clone | FXC00122 |
Source | Human adult brain |
Rouge ID |
mKIAA0740
by Kazusa Mouse cDNA Project
|
Note | We replaced hk03989, former representative clones for KIAA0740 with hk03989s1. (2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2040 bp |
---|---|
Genome contig ID | gi89161187r_62199206 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | r | 62299206 | 62373930 | 11 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001806 | 15 | 36 | PR00449 | Ras GTPase |
IPR001806 | 71 | 93 | PR00449 | Ras GTPase | |
IPR001806 | 131 | 144 | PR00449 | Ras GTPase | |
IPR001806 | 185 | 207 | PR00449 | Ras GTPase | |
HMMPfam | IPR013753 | 100 | 209 | PF00071 | Ras |
IPR013069 | 260 | 457 | PF00651 | BTB/POZ | |
IPR013069 | 475 | 583 | PF00651 | BTB/POZ | |
HMMSmart | IPR003577 | 12 | 210 | SM00173 | Ras small GTPase |
IPR003579 | 15 | 210 | SM00175 | Ras small GTPase | |
IPR003578 | 17 | 210 | SM00174 | Ras small GTPase | |
IPR000210 | 266 | 457 | SM00225 | BTB/POZ-like | |
IPR000210 | 485 | 583 | SM00225 | BTB/POZ-like | |
HMMTigr | IPR005225 | 12 | 188 | TIGR00231 | Small GTP-binding protein domain |
ProfileScan | IPR000210 | 266 | 427 | PS50097 | BTB/POZ-like |
IPR000210 | 485 | 552 | PS50097 | BTB/POZ-like |
![]() |
Primer_f | AGAAGTAGGCTAAGGCAGACC |
---|---|
Primer_r | TCAGAACGAACTCACAATAGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |