Order Kazusa clone(s) from : ![]() |
Product ID | ORK00141 |
---|---|
Accession No | AB020685 |
Description | Rho-related BTB domain containing 3 |
Clone name | hk07361 |
Vector information | |
cDNA sequence | DNA sequence (4099 bp) Predicted protein sequence (687 aa) |
Flexi ORF Clone | FXC00141 |
Source | Human adult brain |
Rouge ID |
mKIAA0878
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1928 bp |
---|---|
Genome contig ID | gi51511721f_94992808 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (163756 - 163805) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 5 | f | 95092808 | 95156562 | 12 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013069 | 490 | 594 | PF00651 | BTB/POZ |
HMMSmart | IPR000210 | 330 | 462 | SM00225 | BTB/POZ-like |
IPR000210 | 496 | 594 | SM00225 | BTB/POZ-like | |
ProfileScan | IPR000210 | 330 | 432 | PS50097 | BTB/POZ-like |
IPR000210 | 496 | 557 | PS50097 | BTB/POZ-like |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
SOSUI2 | 1 | 559 | CCPAGIFQAMCLLICAEMYQVSR | 581 | PRIMARY | 23 |
![]() |
Primer_f | GGCTGGCAAGGGAGAAATGTG |
---|---|
Primer_r | AAAGTTAGGCTGGTTAGTCAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |