KIAA0878

Product ID	ORK00141
Accession No	AB020685
Description	Rho-related BTB domain containing 3
Clone name	hk07361
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4099 bp) Predicted protein sequence (687 aa)
HaloTag ORF Clone	FHC00141
Flexi ORF Clone	FXC00141
Source	Human adult brain
Rouge ID	mKIAA0878 by Kazusa Mouse cDNA Project

Length: 4099 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1928 bp
Genome contig ID	gi51511721f_94992808
PolyA signal sequence (None)	+--------+--------+----*----+---- CTCCAGCCTGGGTGACAAGAGCGAAACTCCATCTC
Flanking genome sequence (163756 - 163805)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAACCAAAGTGAAACACTAAAAATTCCCTATAGATAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	95092808	95156562	12	99.9	Perfect prediction

Length: 687 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_517647	98.8	rho-related BTB...	Pan troglodytes
XP_001090858	98.5	rho-related BTB...	Macaca mulatta
EAW96052	100.0	Rho-related BTB...	Homo sapiens
AAH41337	99.8	Rho-related BTB...	Homo sapiens
O94955	99.8	Rho-related BTB...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018283	3.5e-13	24.1	KIAA0740
AB018260	2.7e-12	25.0	KIAA0717

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	490	594	PF00651	BTB/POZ
HMMSmart	IPR000210	330	462	SM00225	BTB/POZ-like
HMMSmart	IPR000210	496	594	SM00225	BTB/POZ-like
ProfileScan	IPR000210	330	432	PS50097	BTB/POZ-like
ProfileScan	IPR000210	496	557	PS50097	BTB/POZ-like

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	559	CCPAGIFQAMCLLICAEMYQVSR	581	PRIMARY	23

Primer_f	GGCTGGCAAGGGAGAAATGTG
Primer_r	AAAGTTAGGCTGGTTAGTCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-