KIAA0719

Product ID	ORK00612
Accession No	AB018262
Description	translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae)
Clone name	hk01141
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4017 bp) Predicted protein sequence (624 aa)
HaloTag ORF Clone	FHC00612
Flexi ORF Clone	FXC00612
Source	Human adult brain
Rouge ID	mKIAA0719 by Kazusa Mouse cDNA Project

Length: 4017 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2099 bp
Genome contig ID	gi89161205r_101464999
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- CTCACATGTAAATTCACCAAATAAATATTACATTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGCTCTTCTATCTATTCTTTAAATAGAAAGATAGGTAGTTTAGGCTGGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	101564999	101602574	12	100.0	Perfect prediction

Length: 624 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O94826	2e-215	100.0	Mitochondrial i...	Homo sapiens
XP_526255	3.3e-215	99.8	translocase of ...	Pan troglodytes
XP_001092332	3.8e-214	99.3	translocase of ...	Macaca mulatta
XP_535719	2.8e-213	96.3	similar to Mito...	Canis lupus fam...
XP_001917360	2.9e-210	95.3	similar to Mito...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028960	0.00016	28.7	KIAA1037

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001440	130	163	PF00515	Tetratricopeptide TPR_1
	IPR001440	169	202	PF00515	Tetratricopeptide TPR_1
	IPR001440	203	236	PF00515	Tetratricopeptide TPR_1
	IPR001440	345	378	PF00515	Tetratricopeptide TPR_1
	IPR001440	383	416	PF00515	Tetratricopeptide TPR_1
	IPR001440	417	450	PF00515	Tetratricopeptide TPR_1
	IPR013105	492	525	PF07719	Tetratricopeptide TPR_2
	IPR001440	561	594	PF00515	Tetratricopeptide TPR_1
HMMSmart	IPR013026	130	163	SM00028	Tetratricopeptide region
	IPR013026	169	202	SM00028	Tetratricopeptide region
	IPR013026	203	236	SM00028	Tetratricopeptide region
	IPR013026	345	378	SM00028	Tetratricopeptide region
	IPR013026	383	416	SM00028	Tetratricopeptide region
	IPR013026	417	450	SM00028	Tetratricopeptide region
	IPR013026	458	491	SM00028	Tetratricopeptide region
	IPR013026	492	525	SM00028	Tetratricopeptide region
	IPR013026	526	560	SM00028	Tetratricopeptide region
	IPR013026	561	594	SM00028	Tetratricopeptide region
ProfileScan	IPR013026	130	163	PS50005	Tetratricopeptide region
	IPR013026	130	594	PS50293	Tetratricopeptide region
	IPR013026	169	202	PS50005	Tetratricopeptide region
	IPR013026	345	378	PS50005	Tetratricopeptide region
	IPR013026	383	416	PS50005	Tetratricopeptide region
	IPR013026	417	450	PS50005	Tetratricopeptide region
	IPR013026	492	525	PS50005	Tetratricopeptide region
	IPR013026	561	594	PS50005	Tetratricopeptide region

Primer_f	ATCTCTGAATGACCTCTGACT
Primer_r	GGAATGACAGTATAGAATGGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ATCTCTGAATGACCTCTGACT
Primer_r	GGAATGACAGTATAGAATGGC
PCR product length	160 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles