Gene/Protein Characteristic Table for KIAA0742
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01605
Accession No AB018285
Description lysine (K)-specific demethylase 3A, transcript variant 1
Clone name hk04073s2
Vector information
The cDNA fragment was inserted at the EcoRV-NotI site of the ...
cDNA sequence DNA sequence (4652 bp)
Predicted protein sequence (1338 aa)
Flexi ORF Clone FXC01605
Source Human adult brain
Rouge ID mKIAA0742 by Kazusa Mouse cDNA Project
Note We replaced hk04073s1 and hk04073, former representative clones for KIAA0742 with hk04073s2. (2013/5/10,2002/5/10)
Features of the cloned cDNA sequence
Description

Length: 4652 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 1338 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_525805 0 99.9 lysine-specific...
Pan troglodytes
EAW99453 0 100.0 jumonji domain ...
Homo sapiens
Q9Y4C1 0 100.0 Lysine-specific...
Homo sapiens
CAH18373 0 99.9 hypothetical pr...
Homo sapiens
CAE45820 0 99.8 hypothetical pr...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB029005 6e-97 79.9 KIAA1082
AB037801 6.6e-66 71.3 KIAA1380
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR013129 1168 1281 PF02373 Transcription factor jumonji
HMMSmart IPR003347 1075 1298 SM00558 Transcription factor jumonji/aspartyl beta-hydroxylase
ProfileScan IPR003347 1075 1298 PS51184 Transcription factor jumonji/aspartyl beta-hydroxylase
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f ACCTCGTATCAGCTCTGGAAC
Primer_r CTGTCACTTCCTCCATTGCTC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 2
Experimental conditions
Panel name GeneBridge 4
Primer_f ACCTCGTATCAGCTCTGGAAC
Primer_r CTGTCACTTCCTCCATTGCTC
PCR product length 172 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp