Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK05559 |
---|---|
Accession No | AB029005 |
Description | lysine (K)-specific demethylase 3B |
Clone name | fg06837 |
Vector information | |
cDNA sequence | DNA sequence (6691 bp) Predicted protein sequence (1787 aa) |
HaloTag ORF Clone |
FHC05559
|
Flexi ORF Clone | FXC05559 |
Source | Human fetal brain |
Rouge ID |
mKIAA1082
by Kazusa Mouse cDNA Project
|
Note | We replaced hj07386, former representative clones for KIAA1082 with fg06837. (2001/5/29) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1325 bp |
---|---|
Genome contig ID | gi51511721f_137616400 |
PolyA signal sequence (ATTAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (184217 - 184266) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 5 | f | 137716304 | 137800615 | 24 | 99.7 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013129 | 1619 | 1730 | PF02373 | Transcription factor jumonji |
HMMSmart | IPR003347 | 1524 | 1747 | SM00558 | Transcription factor jumonji/aspartyl beta-hydroxylase |
ProfileScan | IPR003347 | 1524 | 1747 | PS51184 | Transcription factor jumonji/aspartyl beta-hydroxylase |
RT-PCR-ELISA |
Primer_f | TCCCATCTTAGTCTTACCTTG |
---|---|
Primer_r | GAAACATTAAGAGGAGTCCCC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TCCCATCTTAGTCTTACCTTG |
Primer_r | GAAACATTAAGAGGAGTCCCC |
PCR product length | 158 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |