Gene/Protein Characteristic Table for KIAA0811
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK04990
Accession No AB160984
Description FAT atypical cadherin 2
Clone name hj04806
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4846 bp)
Predicted protein sequence (1123 aa)
Source Human adult brain
Rouge ID mKIAA0811 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4846 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 1473 bp
Genome contig ID gi51511721r_150763955
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
TTTTTTTTAACAATAAAGTATCTTTTTTTACTGTT
Flanking genome sequence
(99892 - 99843)
----+----*----+----*----+----*----+----*----+----*
ATTTTCTGTGTCCTTTAGCCTGTTTGGGGTCAGGGGAACGATGCAAGGGT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 5 r 150863847 150891731 11 99.3 Perfect prediction
Features of the protein sequence
Description

Length: 1123 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9NYQ8 0 92.8 Protocadherin F...
Homo sapiens
NP_001438 0 92.8 FAT tumor suppr...
Homo sapiens
EAW61673 0 92.6 FAT tumor suppr...
Homo sapiens
XP_001168406 0 91.9 FAT tumor suppr...
Pan troglodytes
XP_001110265 0 89.1 similar to FAT ...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
D87469 2.1e-22 26.1 KIAA0279
AB076400 3.3e-19 27.4 KIAA1989
AB053446 3.4e-18 32.5 KIAA1773
AB002325 9.6e-18 33.5 KIAA0327
AB053445 5.7e-16 31.1 KIAA1774
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR002126 122 141 PR00205 Cadherin
IPR002126 181 210 PR00205 Cadherin
IPR002126 251 263 PR00205 Cadherin
IPR002126 265 284 PR00205 Cadherin
IPR002126 284 297 PR00205 Cadherin
IPR002126 339 365 PR00205 Cadherin
IPR002126 373 390 PR00205 Cadherin
HMMPfam IPR002126 1 69 PF00028 Cadherin
IPR002126 83 172 PF00028 Cadherin
IPR002126 186 277 PF00028 Cadherin
IPR002126 291 382 PF00028 Cadherin
IPR002126 396 480 PF00028 Cadherin
IPR006209 725 757 PF00008 EGF-like
IPR006209 764 795 PF00008 EGF-like
HMMSmart IPR002126 1 76 SM00112 Cadherin
IPR002126 101 179 SM00112 Cadherin
IPR002126 203 284 SM00112 Cadherin
IPR002126 308 389 SM00112 Cadherin
IPR002126 413 487 SM00112 Cadherin
IPR001881 721 758 SM00179 EGF-like calcium-binding
IPR006210 724 758 SM00181 EGF
IPR001881 761 796 SM00179 EGF-like calcium-binding
IPR006210 763 796 SM00181 EGF
ProfileScan IPR002126 1 78 PS50268 Cadherin
IPR002126 79 181 PS50268 Cadherin
IPR002126 182 286 PS50268 Cadherin
IPR002126 287 391 PS50268 Cadherin
IPR002126 392 502 PS50268 Cadherin
IPR000742 721 758 PS50026 EGF-like
IPR000742 760 796 PS50026 EGF-like
ScanRegExp IPR002126 274 284 PS00232 Cadherin
IPR013032 746 757 PS00022 EGF-like region
IPR013032 784 795 PS00022 EGF-like region
IPR013032 784 795 PS01186 EGF-like region

Prediction of transmembrane (TM) segments
Method No. N terminal transmembrane region C terminal type length
SOSUI2 1 822 ELLIITVAVAFIIISTVGLLFYC 844 PRIMARY 23
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f ACTCACACAAATTGGCTCTCG
Primer_r GGTCCACTGCCTTTTCATATG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 5
Experimental conditions
Panel name UniGene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp