KIAA0843

Product ID	ORK00653
Accession No	AB020650
Description	actin binding LIM protein family, member 3, transcript variant 2
Clone name	hk05155
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4256 bp) Predicted protein sequence (691 aa)
HaloTag ORF Clone	FHC00653
Flexi ORF Clone	FXC00653
Source	Human adult brain
Rouge ID	mKIAA0843 by Kazusa Mouse cDNA Project

Length: 4256 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2032 bp
Genome contig ID	gi51511721f_148401326
PolyA signal sequence (CATAAA,-25)	+--------+--------+----*----+---- TTTTGTTTCCCATAAAAGCACATCATTTCAACCCT
Flanking genome sequence (218868 - 218917)	----+--------+--------+--------+--------+----* AAACCTGTGTGCTTCTGTTGTTTCTTGTGTGGGAGTGGAAATGACTGACA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	148501326	148620192	23	99.4	Perfect prediction

Length: 691 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O94929	100.0	Actin-binding L...	Homo sapiens
BAF82425	99.9	unnamed protein...	Homo sapiens
XP_001162953	99.9	actin binding L...	Pan troglodytes
XP_855146	98.4	similar to Acti...	Canis lupus fam...
AAI42520	98.1	ABLIM3 protein ...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D31883	4.6e-76	52.8	KIAA0059
AB058711	3e-50	49.5	KIAA1808
AB014513	0.00011	31.1	KIAA0613

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001781	31	85	PD000094	Zinc finger
	IPR001781	88	141	PD000094	Zinc finger
	IPR001781	158	211	PD000094	Zinc finger
	IPR001781	217	255	PD000094	Zinc finger
HMMPfam	IPR001781	31	87	PF00412	Zinc finger
	IPR001781	90	146	PF00412	Zinc finger
	IPR001781	159	215	PF00412	Zinc finger
	IPR001781	218	275	PF00412	Zinc finger
	IPR003128	656	691	PF02209	Villin headpiece
HMMSmart	IPR001781	30	81	SM00132	Zinc finger
	IPR001781	89	141	SM00132	Zinc finger
	IPR001781	158	209	SM00132	Zinc finger
	IPR001781	217	269	SM00132	Zinc finger
	IPR003128	656	691	SM00153	Villin headpiece
ProfileScan	IPR001781	29	88	PS50023	Zinc finger
	IPR001781	89	148	PS50023	Zinc finger
	IPR001781	157	216	PS50023	Zinc finger
	IPR001781	217	276	PS50023	Zinc finger
	IPR003128	623	691	PS51089	Villin headpiece
ScanRegExp	IPR001781	31	64	PS00478	Zinc finger
	IPR001781	90	123	PS00478	Zinc finger
	IPR001781	159	193	PS00478	Zinc finger
	IPR001781	218	251	PS00478	Zinc finger

Primer_f	TCTGCTGTGTTCTCATGTAGG
Primer_r	AACCAGTGACAATAAGGCAAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TCTGCTGTGTTCTCATGTAGG
Primer_r	AACCAGTGACAATAAGGCAAC
PCR product length	135 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles