KIAA1808

Product ID	ORK04018
Accession No	AB058711
Description	actin binding LIM protein family, member 2
Clone name	fk00917
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3282 bp) Predicted protein sequence (539 aa)
Source	Human fetal brain

Length: 3282 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1661 bp
Genome contig ID	gi89161207r_7917956
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CCAGGAAGCCTGGAAAATAAAAGACGATGCATTAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACTTGCGGAAGTACAAGATCACTTGTTATGAACTTGTGTGATTTTAAAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	r	8017956	8159176	16	99.2	Perfect prediction

Length: 539 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAG38375	3.9e-206	100.0	actin binding L...	Homo sapiens
CAG38378	2.6e-191	91.9	actin binding L...	Mus musculus
CAG28315	4.6e-190	91.3	actin binding L...	Rattus norvegicus
Q6H8Q1	1.5e-181	93.1	Actin-binding L...	Homo sapiens
Q8BL65	7.5e-167	85.5	Actin-binding L...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D31883	9.3e-52	50.7	KIAA0059
AB020650	7.5e-47	49.5	KIAA0843
AB014513	0.00048	30.7	KIAA0613

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001781	1	45	PD000094	Zinc finger
	IPR001781	48	101	PD000094	Zinc finger
	IPR001781	120	174	PD000094	Zinc finger
	IPR001781	178	216	PD000094	Zinc finger
HMMPfam	IPR001781	1	47	PF00412	Zinc finger
	IPR001781	50	107	PF00412	Zinc finger
	IPR001781	120	176	PF00412	Zinc finger
	IPR001781	179	237	PF00412	Zinc finger
	IPR003128	504	539	PF02209	Villin headpiece
HMMSmart	IPR001781	1	41	SM00132	Zinc finger
	IPR001781	49	101	SM00132	Zinc finger
	IPR001781	119	170	SM00132	Zinc finger
	IPR001781	178	230	SM00132	Zinc finger
	IPR003128	504	539	SM00153	Villin headpiece
ProfileScan	IPR001781	1	47	PS50023	Zinc finger
	IPR001781	48	108	PS50023	Zinc finger
	IPR001781	118	177	PS50023	Zinc finger
	IPR001781	178	237	PS50023	Zinc finger
	IPR003128	471	539	PS51089	Villin headpiece
ScanRegExp	IPR001781	50	83	PS00478	Zinc finger
	IPR001781	120	154	PS00478	Zinc finger
	IPR001781	179	212	PS00478	Zinc finger

Primer_f	GTAACCTTAAAGACAGACCCC
Primer_r	ACAAGGACGGTGCATCAAGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-