KIAA0059

Product ID	ORK01955
Accession No	D31883
Description	actin binding LIM protein 1, transcript variant 2
Clone name	ha00949s1
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a cDNA fragment (1-1242) was subcloned upstream of the cDNA (1243-7405). The adjacent sequence to the 5' end of the cDNA is as follows: CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA.
cDNA sequence	DNA sequence (7405 bp) Predicted protein sequence (724 aa)
HaloTag ORF Clone	FHC01955
Flexi ORF Clone	FXC01955
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0059 by Kazusa Mouse cDNA Project
Note	We replaced ha00949, former representative clones for KIAA0059 with ha00949s1. (2002/5/10)

Length: 7405 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	5144 bp
Genome contig ID	gi89161187r_116080862
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- ACAACTTCGTGAATAAAGTTGTGTGCTTTATTCGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGATGCCTCCATACCTGTGTTTCATTTCTCGTTCCCTGGCTCCCTTTGAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	r	116180862	116434206	22	99.2	Perfect prediction

Length: 724 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG72442	100.0	actin binding L...	synthetic construct
CAI10910	99.7	actin binding L...	Homo sapiens
CAI10907	99.7	actin binding L...	Homo sapiens
O14639	99.4	Actin-binding L...	Homo sapiens
AAC51676	99.1	actin-binding d...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020650	3.7e-69	52.8	KIAA0843
AB058711	2.2e-50	50.7	KIAA1808
AB014513	0.00014	30.6	KIAA0613

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001781	43	99	PD000094	Zinc finger
	IPR001781	102	155	PD000094	Zinc finger
	IPR001781	172	226	PD000094	Zinc finger
	IPR001781	230	268	PD000094	Zinc finger
HMMPfam	IPR001781	45	101	PF00412	Zinc finger
	IPR001781	104	160	PF00412	Zinc finger
	IPR001781	172	228	PF00412	Zinc finger
	IPR001781	231	287	PF00412	Zinc finger
	IPR003128	689	724	PF02209	Villin headpiece
HMMSmart	IPR001781	44	95	SM00132	Zinc finger
	IPR001781	103	155	SM00132	Zinc finger
	IPR001781	171	222	SM00132	Zinc finger
	IPR001781	230	282	SM00132	Zinc finger
	IPR003128	689	724	SM00153	Villin headpiece
ProfileScan	IPR001781	43	102	PS50023	Zinc finger
	IPR001781	103	162	PS50023	Zinc finger
	IPR001781	170	229	PS50023	Zinc finger
	IPR001781	230	289	PS50023	Zinc finger
	IPR003128	656	724	PS51089	Villin headpiece
ScanRegExp	IPR001781	45	78	PS00478	Zinc finger
	IPR001781	104	137	PS00478	Zinc finger
	IPR001781	172	206	PS00478	Zinc finger
	IPR001781	231	264	PS00478	Zinc finger

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	TGGTTTGGGGTTAGTTATGAA
Primer_r	CCGAGTTAGAGTTGATTGATA
PCR product length	281 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles