Order Kazusa clone(s) from : ![]() |
Product ID | ORK00665 |
---|---|
Accession No | AB020670 |
Description | ADNP homeobox 2 |
Clone name | hk06535 |
Vector information | |
cDNA sequence | DNA sequence (4313 bp) Predicted protein sequence (1181 aa) |
Flexi ORF Clone | FXC00665 |
Source | Human adult brain |
Rouge ID |
mKIAA0863
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 732 bp |
---|---|
Genome contig ID | gi51511735f_75868257 |
PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (130157 - 130206) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 18 | f | 75968173 | 75998412 | 4 | 99.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMSmart | IPR015880 | 123 | 146 | SM00355 | Zinc finger |
IPR015880 | 156 | 178 | SM00355 | Zinc finger | |
IPR015880 | 205 | 228 | SM00355 | Zinc finger | |
IPR015880 | 265 | 290 | SM00355 | Zinc finger | |
IPR015880 | 744 | 766 | SM00355 | Zinc finger | |
IPR015880 | 797 | 818 | SM00355 | Zinc finger | |
IPR015880 | 820 | 843 | SM00355 | Zinc finger | |
IPR015880 | 925 | 948 | SM00355 | Zinc finger | |
IPR001356 | 1093 | 1155 | SM00389 | Homeobox | |
ProfileScan | IPR007087 | 820 | 848 | PS50157 | Zinc finger |
ScanRegExp | IPR007087 | 822 | 843 | PS00028 | Zinc finger |
IPR007087 | 927 | 949 | PS00028 | Zinc finger |
![]() |
Primer_f | TCGATCTCCTTCAGCTTTCCC |
---|---|
Primer_r | GAAGTCAGCGTAAGTTAATGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TCGATCTCCTTCAGCTTTCCC |
Primer_r | GAAGTCAGCGTAAGTTAATGC |
PCR product length | 126 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |