Order Kazusa clone(s) from : ![]() |
Product ID | ORK00667 |
---|---|
Accession No | AB020680 |
Description | BCL2-associated athanogene 5, transcript variant 2 |
Clone name | hk07246 |
Vector information | |
cDNA sequence | DNA sequence (4119 bp) Predicted protein sequence (466 aa) |
Flexi ORF Clone | FXC00667 |
Source | Human adult brain |
Rouge ID |
mKIAA0873
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2718 bp |
---|---|
Genome contig ID | gi51511730r_102993192 |
PolyA signal sequence (ATTAAA,-28) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 14 | r | 103093192 | 103098734 | 2 | 99.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR003103 | 28 | 105 | PF02179 | Apoptosis regulator Bcl-2 protein |
IPR003103 | 201 | 279 | PF02179 | Apoptosis regulator Bcl-2 protein | |
IPR003103 | 294 | 369 | PF02179 | Apoptosis regulator Bcl-2 protein | |
IPR003103 | 384 | 461 | PF02179 | Apoptosis regulator Bcl-2 protein | |
HMMSmart | IPR003103 | 28 | 105 | SM00264 | Apoptosis regulator Bcl-2 protein |
IPR003103 | 201 | 279 | SM00264 | Apoptosis regulator Bcl-2 protein | |
IPR003103 | 294 | 369 | SM00264 | Apoptosis regulator Bcl-2 protein | |
IPR003103 | 384 | 461 | SM00264 | Apoptosis regulator Bcl-2 protein | |
ProfileScan | IPR003103 | 28 | 105 | PS51035 | Apoptosis regulator Bcl-2 protein |
IPR003103 | 201 | 279 | PS51035 | Apoptosis regulator Bcl-2 protein | |
IPR003103 | 294 | 369 | PS51035 | Apoptosis regulator Bcl-2 protein | |
IPR003103 | 384 | 461 | PS51035 | Apoptosis regulator Bcl-2 protein |
![]() |
Primer_f | CACCGGATTTAGCTCTTGTCG |
---|---|
Primer_r | ATGGACTACAGCGTTTAATGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |