Order Kazusa clone(s) from : ![]() |
Product ID | ORK00685 |
---|---|
Accession No | AB023141 |
Description | zinc finger protein 652, transcript variant 2 |
Clone name | hh02883 |
Vector information | |
cDNA sequence | DNA sequence (5428 bp) Predicted protein sequence (617 aa) |
HaloTag ORF Clone |
FHC00685
![]() |
Flexi ORF Clone | FXC00685 |
Source | Human adult brain |
Rouge ID |
mKIAA0924
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3288 bp |
---|---|
Genome contig ID | gi51511734r_44627568 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (88605 - 88556) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 17 | r | 44716173 | 44794834 | 9 | 98.6 | Internal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR007087 | 452 | 475 | PD000003 | Zinc finger |
HMMPfam | IPR007087 | 256 | 279 | PF00096 | Zinc finger |
IPR007087 | 283 | 306 | PF00096 | Zinc finger | |
IPR007087 | 310 | 333 | PF00096 | Zinc finger | |
IPR007087 | 340 | 362 | PF00096 | Zinc finger | |
IPR007087 | 368 | 390 | PF00096 | Zinc finger | |
IPR007087 | 396 | 418 | PF00096 | Zinc finger | |
IPR007087 | 424 | 446 | PF00096 | Zinc finger | |
IPR007087 | 452 | 474 | PF00096 | Zinc finger | |
IPR007087 | 480 | 502 | PF00096 | Zinc finger | |
HMMSmart | IPR015880 | 256 | 279 | SM00355 | Zinc finger |
IPR015880 | 283 | 303 | SM00355 | Zinc finger | |
IPR015880 | 310 | 333 | SM00355 | Zinc finger | |
IPR015880 | 340 | 362 | SM00355 | Zinc finger | |
IPR015880 | 368 | 390 | SM00355 | Zinc finger | |
IPR015880 | 396 | 418 | SM00355 | Zinc finger | |
IPR015880 | 424 | 446 | SM00355 | Zinc finger | |
IPR015880 | 452 | 474 | SM00355 | Zinc finger | |
IPR015880 | 480 | 500 | SM00355 | Zinc finger | |
ProfileScan | IPR007087 | 256 | 284 | PS50157 | Zinc finger |
IPR007087 | 283 | 310 | PS50157 | Zinc finger | |
IPR007087 | 310 | 338 | PS50157 | Zinc finger | |
IPR007087 | 340 | 367 | PS50157 | Zinc finger | |
IPR007087 | 368 | 395 | PS50157 | Zinc finger | |
IPR007087 | 396 | 423 | PS50157 | Zinc finger | |
IPR007087 | 424 | 451 | PS50157 | Zinc finger | |
IPR007087 | 452 | 479 | PS50157 | Zinc finger | |
IPR007087 | 480 | 508 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 258 | 279 | PS00028 | Zinc finger |
IPR007087 | 312 | 333 | PS00028 | Zinc finger | |
IPR007087 | 342 | 362 | PS00028 | Zinc finger | |
IPR007087 | 370 | 390 | PS00028 | Zinc finger | |
IPR007087 | 398 | 418 | PS00028 | Zinc finger | |
IPR007087 | 426 | 446 | PS00028 | Zinc finger | |
IPR007087 | 454 | 474 | PS00028 | Zinc finger |
![]() |
Primer_f | GTACACATTCTTTGAGCACCC |
---|---|
Primer_r | AATACTACAGGCTTGACCATG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ACCACCATCCTTAACAGAAAC |
Primer_r | ACCACAAGTCTCAAGTCAAGG |
PCR product length | 162 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |