Order Kazusa clone(s) from : ![]() |
Product ID | ORK07490 |
---|---|
Accession No | AB046835 |
Description | zinc finger protein 529 |
Clone name | fj13419 |
Vector information | |
cDNA sequence | DNA sequence (3934 bp) Predicted protein sequence (484 aa) |
Source | Human fetal brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2478 bp |
---|---|
Genome contig ID | gi42406306r_41627134 |
PolyA signal sequence (ATTAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 19 | r | 41727134 | 41731063 | 1 | 99.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR007087 | 203 | 226 | PD000003 | Zinc finger |
IPR007087 | 231 | 254 | PD000003 | Zinc finger | |
IPR007087 | 259 | 282 | PD000003 | Zinc finger | |
IPR007087 | 287 | 310 | PD000003 | Zinc finger | |
IPR007087 | 315 | 338 | PD000003 | Zinc finger | |
IPR007087 | 343 | 366 | PD000003 | Zinc finger | |
IPR007087 | 371 | 394 | PD000003 | Zinc finger | |
IPR007087 | 399 | 422 | PD000003 | Zinc finger | |
IPR007087 | 427 | 450 | PD000003 | Zinc finger | |
HMMPfam | IPR007087 | 203 | 225 | PF00096 | Zinc finger |
IPR007087 | 231 | 253 | PF00096 | Zinc finger | |
IPR007087 | 259 | 281 | PF00096 | Zinc finger | |
IPR007087 | 287 | 309 | PF00096 | Zinc finger | |
IPR007087 | 315 | 337 | PF00096 | Zinc finger | |
IPR007087 | 343 | 365 | PF00096 | Zinc finger | |
IPR007087 | 371 | 393 | PF00096 | Zinc finger | |
IPR007087 | 399 | 421 | PF00096 | Zinc finger | |
IPR007087 | 427 | 449 | PF00096 | Zinc finger | |
HMMSmart | IPR015880 | 203 | 225 | SM00355 | Zinc finger |
IPR015880 | 231 | 253 | SM00355 | Zinc finger | |
IPR015880 | 259 | 281 | SM00355 | Zinc finger | |
IPR015880 | 287 | 309 | SM00355 | Zinc finger | |
IPR015880 | 315 | 337 | SM00355 | Zinc finger | |
IPR015880 | 343 | 365 | SM00355 | Zinc finger | |
IPR015880 | 371 | 393 | SM00355 | Zinc finger | |
IPR015880 | 399 | 421 | SM00355 | Zinc finger | |
IPR015880 | 427 | 449 | SM00355 | Zinc finger | |
ProfileScan | IPR007087 | 120 | 147 | PS50157 | Zinc finger |
IPR007087 | 203 | 230 | PS50157 | Zinc finger | |
IPR007087 | 231 | 258 | PS50157 | Zinc finger | |
IPR007087 | 259 | 286 | PS50157 | Zinc finger | |
IPR007087 | 287 | 314 | PS50157 | Zinc finger | |
IPR007087 | 315 | 342 | PS50157 | Zinc finger | |
IPR007087 | 343 | 370 | PS50157 | Zinc finger | |
IPR007087 | 371 | 398 | PS50157 | Zinc finger | |
IPR007087 | 399 | 426 | PS50157 | Zinc finger | |
IPR007087 | 427 | 454 | PS50157 | Zinc finger | |
IPR007087 | 455 | 482 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 205 | 225 | PS00028 | Zinc finger |
IPR007087 | 233 | 253 | PS00028 | Zinc finger | |
IPR007087 | 261 | 281 | PS00028 | Zinc finger | |
IPR007087 | 289 | 309 | PS00028 | Zinc finger | |
IPR007087 | 317 | 337 | PS00028 | Zinc finger | |
IPR007087 | 345 | 365 | PS00028 | Zinc finger | |
IPR007087 | 373 | 393 | PS00028 | Zinc finger | |
IPR007087 | 401 | 421 | PS00028 | Zinc finger | |
IPR007087 | 429 | 449 | PS00028 | Zinc finger |
![]() |
Primer_f | GCCAACCGAAAATTTACACTG |
---|---|
Primer_r | AACAGACTTTAAGAGAGGGAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | CCR |
---|---|
Primer_f | GCCAACCGAAAATTTACACTG |
Primer_r | AACAGACTTTAAGAGAGGGAG |
PCR product length | 150 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |