KIAA0933

Product ID	ORK04825
Accession No	AB023150
Description	dopey family member 2
Clone name	hh04045s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6994 bp) Predicted protein sequence (2147 aa)
Source	Human adult brain
Rouge ID	mKIAA0933 by Kazusa Mouse cDNA Project
Note	We replaced hh04045, former representative clones for KIAA0933 with hh04045s1. (2002/5/10)

Length: 6994 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	549 bp
Genome contig ID	gi51511750f_36394631
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ATTTATGTAATGAAAATAAAATTAATATATCATCT
Flanking genome sequence (193659 - 193708)	----+--------+--------+--------+--------+----* AACAGTAGCACAAAATTTGTAATATGAAGTAAAGTATGAAGATAATGAAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	21	f	36494631	36588288	34	99.7	Perfect prediction

Length: 2147 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAA89431	100.0	C21orf5 [Homo s...	Homo sapiens
Q9Y3R5	99.9	Protein dopey-2.	Homo sapiens
XP_531552	99.7	pad-1-like isof...	Pan troglodytes
CAB41415	99.6	hypothetical pr...	Homo sapiens
XP_544874	89.4	similar to pad-...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029040	5.8e-121	38.1	KIAA1117

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007249	1	163	PF04118	Dopey

Primer_f	CCCACACTGTCAGGATTCTAG
Primer_r	CTGTCTCTGGGTCTTAAATGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-