Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK05627 |
---|---|
Accession No | AB023168 |
Description | neuroligin 4, Y-linked |
Clone name | hj05306 |
Vector information | |
cDNA sequence | DNA sequence (4935 bp) Predicted protein sequence (679 aa) |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2706 bp |
---|---|
Genome contig ID | gi89161220f_15044026 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (421218 - 421267) |
----+----*----+----*----+----*----+----*----+----* |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR000460 | 299 | 313 | PR01090 | Neuroligin |
IPR000460 | 402 | 423 | PR01090 | Neuroligin | |
IPR000460 | 432 | 450 | PR01090 | Neuroligin | |
IPR000460 | 532 | 561 | PR01090 | Neuroligin | |
HMMPfam | IPR002018 | 1 | 453 | PF00135 | Carboxylesterase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 538 | LSVTIAVGASLLFLNILAFAAL | 559 | PRIMARY | 22 |
---|
RT-PCR-ELISA |
Primer_f | TTCTGCAAGCAATGTATGACC |
---|---|
Primer_r | TAGACAGACAAAACCAGCATG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TTCTGCAAGCAATGTATGACC |
Primer_r | TAGACAGACAAAACCAGCATG |
PCR product length | 103 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |