Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00172 |
---|---|
Accession No | AB028993 |
Description | neuroligin 1 |
Clone name | hj05602 |
Vector information | |
cDNA sequence | DNA sequence (4960 bp) Predicted protein sequence (826 aa) |
HaloTag ORF Clone |
FHC00172
|
Flexi ORF Clone | FXC00172 |
Source | Human adult brain |
Rouge ID |
mKIAA1070
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1819 bp |
---|---|
Genome contig ID | gi89161205f_174685171 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (798438 - 798487) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | f | 174785171 | 175483607 | 6 | 99.2 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR000460 | 455 | 469 | PR01090 | Neuroligin |
IPR000460 | 558 | 579 | PR01090 | Neuroligin | |
IPR000460 | 588 | 606 | PR01090 | Neuroligin | |
IPR000460 | 673 | 702 | PR01090 | Neuroligin | |
HMMPfam | IPR002018 | 36 | 609 | PF00135 | Carboxylesterase |
ScanRegExp | IPR002018 | 154 | 164 | PS00941 | Carboxylesterase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 24 | VHRGLGAPLTLCMLGCLLQAGHV | 46 | SECONDARY | 23 | 2 | 679 | LSVTIAVGASLLFLNILAFAAL | 700 | PRIMARY | 22 |
---|
RT-PCR-ELISA |
Primer_f | TTCATCCCCCTGTTGTTTACC |
---|---|
Primer_r | TCAGGATGTGCTCTTTAAGTC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TGAAGATGCTGCTCCAATACA |
Primer_r | TATACCTCCGATTTCTTACAG |
PCR product length | 106 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |