KIAA1366

Product ID	ORK06161
Accession No	AB037787
Description	neuroligin 2
Clone name	fj02695
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3716 bp) Predicted protein sequence (550 aa)
Source	Human fetal brain
Rouge ID	mKIAA1366 by Kazusa Mouse cDNA Project

Length: 3716 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2061 bp
Genome contig ID	gi51511734f_7159008
PolyA signal sequence (TATAAA,-18)	+--------+--------+----*----+---- GAAGAGAATATTGTAAATATAAAAGTTTAACTGTT
Flanking genome sequence (104897 - 104946)	----+--------+--------+--------+--------+----* GGTTGTGCCTGCTCTGTTGTGGGGAGGGCGGTCTCTAAAGAAACAAGCCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	7259008	7263903	3	99.0	Perfect prediction

Length: 550 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_523830	1.2e-179	100.0	neuroligin 2 [P...	Pan troglodytes
XP_001108431	1.3e-179	100.0	similar to neur...	Macaca mulatta
Q8NFZ4	1.3e-179	100.0	Neuroligin-2; F...	Homo sapiens
XP_001254643	2.5e-179	99.8	neuroligin 2 [B...	Bos taurus
XP_001503121	1.4e-177	98.9	neuroligin 2, p...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028993	1e-52	63.0	KIAA1070
AB033086	3.6e-51	62.5	KIAA1260
AB023168	7.5e-51	62.0	KIAA0951
AB040913	2.5e-50	62.5	KIAA1480

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000460	162	176	PR01090	Neuroligin
	IPR000460	265	286	PR01090	Neuroligin
	IPR000460	295	313	PR01090	Neuroligin
	IPR000460	385	414	PR01090	Neuroligin
HMMPfam	IPR002018	1	316	PF00135	Carboxylesterase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	391	LSVTVAVGASLLFLNILAFAAL	412	PRIMARY	22

Primer_f	TCTTCCACTGACACCCAAATC
Primer_r	CCAATTCTGAGGGCATCTGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-