Gene/Protein Characteristic Table for KIAA1366
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK06161
Accession No AB037787
Description neuroligin 2
Clone name fj02695
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (3716 bp)
Predicted protein sequence (550 aa)
Source Human fetal brain
Rouge ID mKIAA1366 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 3716 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 2061 bp
Genome contig ID gi51511734f_7159008
PolyA signal sequence
(TATAAA,-18)
+----*----+----*----+----*----+----
GAAGAGAATATTGTAAATATAAAAGTTTAACTGTT
Flanking genome sequence
(104897 - 104946)
----+----*----+----*----+----*----+----*----+----*
GGTTGTGCCTGCTCTGTTGTGGGGAGGGCGGTCTCTAAAGAAACAAGCCC

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 17 f 7259008 7263903 3 99.0 Perfect prediction
Features of the protein sequence
Description

Length: 550 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_523830 1.2e-179 100.0 neuroligin 2 [P...
Pan troglodytes
XP_001108431 1.3e-179 100.0 similar to neur...
Macaca mulatta
Q8NFZ4 1.3e-179 100.0 Neuroligin-2; F...
Homo sapiens
XP_001254643 2.5e-179 99.8 neuroligin 2 [B...
Bos taurus
XP_001503121 1.4e-177 98.9 neuroligin 2, p...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB028993 1e-52 63.0 KIAA1070
AB033086 3.6e-51 62.5 KIAA1260
AB023168 7.5e-51 62.0 KIAA0951
AB040913 2.5e-50 62.5 KIAA1480
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR000460 162 176 PR01090 Neuroligin
IPR000460 265 286 PR01090 Neuroligin
IPR000460 295 313 PR01090 Neuroligin
IPR000460 385 414 PR01090 Neuroligin
HMMPfam IPR002018 1 316 PF00135 Carboxylesterase

Prediction of transmembrane (TM) segments
Method No. N terminal transmembrane region C terminal type length
SOSUI2 1 391 LSVTVAVGASLLFLNILAFAAL 412 PRIMARY 22
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TCTTCCACTGACACCCAAATC
Primer_r CCAATTCTGAGGGCATCTGTC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 17
Experimental conditions
Panel name unigene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp