Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00786 |
---|---|
Accession No | AB033086 |
Description | neuroligin 4, X-linked, transcript variant 1 |
Clone name | hh15752 |
Vector information | |
cDNA sequence | DNA sequence (5454 bp) Predicted protein sequence (817 aa) |
HaloTag ORF Clone |
FHC00786
|
Flexi ORF Clone | FXC00786 |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2539 bp |
---|---|
Genome contig ID | gi89161218r_5718319 |
PolyA signal sequence (AATATA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR000460 | 437 | 451 | PR01090 | Neuroligin |
IPR000460 | 540 | 561 | PR01090 | Neuroligin | |
IPR000460 | 570 | 588 | PR01090 | Neuroligin | |
IPR000460 | 670 | 699 | PR01090 | Neuroligin | |
HMMPfam | IPR002018 | 26 | 591 | PF00135 | Carboxylesterase |
ScanRegExp | IPR002018 | 145 | 155 | PS00941 | Carboxylesterase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 13 | LLFTPVCVMLNSNVLLWLTALAI | 35 | PRIMARY | 23 | 2 | 676 | LSVTIAVGASLLFLNILAFAAL | 697 | PRIMARY | 22 |
---|
RT-PCR-ELISA |
Primer_f | AGTAAATACGGCTCTGTGTTC |
---|---|
Primer_r | GATAAATAAGGGACCGAGTGC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AGTAAATACGGCTCTGTGTTC |
Primer_r | GATAAATAAGGGACCGAGTGC |
PCR product length | 135 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |