KIAA0982

Product ID	ORK00160
Accession No	AB023199
Description	WD repeat domain 37
Clone name	hj07125
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4586 bp) Predicted protein sequence (502 aa)
HaloTag ORF Clone	FHC00160
Flexi ORF Clone	FXC00160
Source	Human adult brain
Rouge ID	mKIAA0982 by Kazusa Mouse cDNA Project

Length: 4586 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	2957 bp
Genome contig ID	gi89161187f_985478
PolyA signal sequence (AATATA,-20)	+--------+--------+----*----+---- GCTAGAAATTGAACAAATATAATACTGGTCACTCG
Flanking genome sequence (182761 - 182810)	----+--------+--------+--------+--------+----* AAAAATTTTTAGACTTAAAAAGTCAGTTGTGTTTTGTGTCTGTCTCTTAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	1085478	1168237	14	99.3	Perfect prediction

Length: 502 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG11268	1.4e-198	100.0	WD repeat prote...	synthetic construct
Q9Y2I8	3.3e-198	99.8	WD repeat-conta...	Homo sapiens
XP_001137638	5.9e-198	99.6	hypothetical pr...	Pan troglodytes
XP_001100698	1.9e-197	99.2	WD repeat domai...	Macaca mulatta
BAF85280	1.9e-197	99.6	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	203	234	PD000018	WD40 repeat
	IPR001680	285	318	PD000018	WD40 repeat
	IPR001680	370	403	PD000018	WD40 repeat
FPrintScan	IPR001680	180	194	PR00320	WD40 repeat
	IPR001680	346	360	PR00320	WD40 repeat
	IPR001680	389	403	PR00320	WD40 repeat
HMMPfam	IPR001680	154	193	PF00400	WD40 repeat
	IPR001680	197	235	PF00400	WD40 repeat
	IPR001680	279	317	PF00400	WD40 repeat
	IPR001680	321	359	PF00400	WD40 repeat
	IPR001680	365	402	PF00400	WD40 repeat
	IPR001680	452	492	PF00400	WD40 repeat
HMMSmart	IPR001680	153	193	SM00320	WD40 repeat
	IPR001680	196	235	SM00320	WD40 repeat
	IPR001680	278	317	SM00320	WD40 repeat
	IPR001680	320	359	SM00320	WD40 repeat
	IPR001680	364	402	SM00320	WD40 repeat
	IPR001680	451	492	SM00320	WD40 repeat
ProfileScan	IPR001680	160	202	PS50082	WD40 repeat
	IPR001680	160	501	PS50294	WD40 repeat
	IPR001680	203	234	PS50082	WD40 repeat
	IPR001680	285	326	PS50082	WD40 repeat
	IPR001680	327	368	PS50082	WD40 repeat
	IPR001680	371	411	PS50082	WD40 repeat
ScanRegExp	IPR001680	389	403	PS00678	WD40 repeat
ScanRegExp	IPR001680	479	493	PS00678	WD40 repeat

Primer_f	AAGTCAATATTCCTAGTGGCC
Primer_r	CACATTAGAAGACGACACAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-