KIAA1042

Product ID	ORK01145
Accession No	AB028965
Description	trafficking protein, kinesin binding 1, transcript variant 1
Clone name	fh02877
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5109 bp) Predicted protein sequence (1019 aa)
HaloTag ORF Clone	FHC01145
Flexi ORF Clone	FXC01145
Source	Human fetal brain
Rouge ID	mKIAA1042 by Kazusa Mouse cDNA Project

Length: 5109 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2031 bp
Genome contig ID	gi89161205f_42007750
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- CTAATGAGTATCAATAAAATAAGTTCAAATGATGG
Flanking genome sequence (234516 - 234565)	----+--------+--------+--------+--------+----* AAACCACACTGGTATTCTGATTTGTATTTTGTTTTTATCTTTTCATCAAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	f	42107750	42242264	16	99.4	Perfect prediction

Length: 1019 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UPV9	100.0	Trafficking kin...	Homo sapiens
XP_542729	97.1	similar to 106 ...	Canis lupus fam...
XP_001497664	96.3	trafficking pro...	Equus caballus
AAH58971	93.4	Trafficking pro...	Mus musculus
EAW64640	97.0	trafficking pro...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011121	2.5e-17	46.7	KIAA0549

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006933	113	420	PF04849	HAP1
ScanRegExp	IPR000585	804	819	PS00024	Hemopexin

Primer_f	CTGGCAATGATGAGTGGCTTC
Primer_r	TCCCTGCTGTTGTATGTGTGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-